ZFIN ID: ZDB-TSCRIPT-090929-10191
Transcript Name: zgc:113411-201
Previous Name: zgc:113411-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027644 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027644|OTTDARG00000021664|ZDB-GENE-050417-474 zgc:113411|OTTDARP00000022641 DKEY-68O6.1-001 LG_ BX569789.4 Danio rerio protein_coding KNOWN, 1810 bp
AGATGTGTGTGATGTGTTCAATAGTGAGAAACTCATCCAC
TTCCCGCTCTTCAAAAAATGCAGATAATACAGCGGCCTCA
TTCATGAAATGACTCTTCAGCCCTTTCTGGAATCTGCTCG
ACTCCGTGAGAACAGCAGAAACAACAATCACAACCAACCG
GGTGAAGAAGGATGAAGAAAAAAAGCTGCAAGAAATCACG
CCAGATCAGGTCGTCCTCCATCTGCAGCTCCAAGAGAAAG
AAACAAGCTAAAAGCAAAAACTGCCTCCAATCGTCTTCAA
GTCAATCCCGACTTCCTGTTACGTGTGGATATAAAGAGGG
GTTACTGGATTTGAAGAAATATTATAAAAGGCAAAAGTGC
ATCTTAAGTGAAGACCGCTGGTTTACGCCCACTGAGTTTG
AGAGGTTTGGGAGAAAGGAGAAAAACAAAAAGTGGAGGAC
CAGCATCCTTTGCAAAGGGATTACACTCCAGAAACTCATA
GAGGATGGATTTCTTTTACCTAAAACCTTTATGAAAGGCA
GGATTCATGGTGAAAAGCAGAAGAAAAGGCCAGAGGTTTT
GCAGCAGCAGGTGTTAGAATCAGCTGAGAAGAGTAATGGC
AGTCAAGGAGAGGATGACGATGATATTGACATGACCAAGT
TCGAAGGTGCGACATTACCTGTGGCCTGCGGTTCAAACTC
TGGTGTCCTACACAAGTGCCGCTTTGCTGGAGAGCGTTGT
GGGAGATGCATAAGAACAGAGAACTCCTGGTTGACGCCTG
AGGGTTTCATCAAATTGAACAAGCCAGATGGAATATGGAG
GAAAGACATTGTTTCCAATGGAGTTCCTCTCGGAAGACTT
ATAAAGAAAAAGGTTTTGGAACTACATACAATCAACTGTG
ACTGTGAGATCTGCCAAGAACTGGATCAGCACCTCAATGA
TGATGTGTGTTTTGTGTGCAACTCTGAGGGAAATCTGGTG
TGTTGTGATGAATGTCCACGAGCGTTTCATCACCACTGTC
ACCTACCAGCTGTGCCTGAAGATTCATCTGGCAAGTGGAG
CTGCATAATTTGTGTGCTGAAGAATATGAAAGGTTCCAGT
CAAAAGAACCAACAGGATATTATGAGCAGTCCAGTTTCTC
AGTACACACAGCACTGCCAGTGTCTGCTGTTACACCTGCT
GCGTGAGTGCATGACTGACCCCTGCACCAATATTCCCGGA
GGCAGTGAGAACATTTGTGGTCCCATGATGCTGGGCAGAG
TCAAACAGAATTTGGAGAATAATAATTGTCCGACGGTGCA
AGTGTTTGTCTCAGATATTGAATATGTCTTCCACCACTGC
ACCTCCAAAAGGGATAATGACTTCAGCAGAATGATGTCTA
GACTCATGGAGCTGCTTGAAACCATCTTTAAACCTTAACG
TTTGTGTGTTTTGTACAGAAATTACAGGGGGAATAAAGAG
CAATATGTATGCATCATATATTTTAATTGCTGTTCATCAA
ACTCGAAATTTAAAAACTTAAGAAAAAAAATATATATTTT
AAAATAATATTTAATTTTATAAATTTTTGTAATATATTTT
AGACATTTTTTTGTCAAGAACAATGTTATGATTTTAGTGT
TTGCATTATGACAAAACTGAGTTTGGAATAGTATTTATCA
CCACCACCATCATTATCATCATCATATTCTTCTCTTATAA
TTAAGATTATTTTACTTTAAGTTACAATTTAGACAATACA
GCTTTGTATCTTAAAGACTGTAAAATATTTTAATGTTGTT
TCTGCTGTTGCAATATGGCAAAAGAAATAACATACTGTGT
TTCCAGACCA

sp100.4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:113411-201 1810
zgc:113411-202 (1)    Ensembl 477
ncRNA zgc:113411-003 (1)    Ensembl 994
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:113411-201 Contained in:
[BAC] DKEY-68O6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000027644 (1),  Ensembl_Trans:ENSDART00000055590 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC093591 (1) 1470 nt
GenBank:EH536431 (1) 963 nt
GenBank:EH557691 (1) 899 nt
GenBank:DV599017 (1) 879 nt
GenBank:BM264747 (1) 562 nt
GenBank:CO356432 (1) 555 nt
CITATIONS (2)