header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-659
Transcript Name: glrx2-201
Previous Name: glrx2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045956 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045956|OTTDARG00000032829|ZDB-GENE-040718-101 glrx2|OTTDARP00000036262 glrx2-001 LG_ FP928987.5 Danio rerio protein_coding KNOWN, 1003 bp
GACGTGTTTTTACACTGTTCAGGACCGCACAAGTTAGCCC
ACTTTAGCAGACAAAGGCGATGTTGTATTTGGGGTCATTA
GATGTTTAAATCCCCCCTGTGATCTGATCAGATTACGGTC
TAGCTGTGAGGTCATTGTTAGTTAGTTGATTCAAGAGGAG
ACCACATCAGTTTGAAGATGATTGACTTAAATTGCCAGTC
GAATTCTCTTGTGTCTGCATTAACTGCGTTTGCTTTCCTA
GTATCTTCAACATGTTTCTTTTACAGACCGGTGATTATTA
CAAGAATGGGGAACTTCTCGTCATCTGCGCCTGGGTTGTC
AAGCTCAGCTTGTGGTCAGTTTGTGCAGGATATTGTGTCC
AGTAACTGTGTTGTAATATTCTCCAAAACAACATGTCCTT
ACTGTAAGATGGCAAAGGGTGTCTTTAATGAGATTGGAGC
TACGTATAAAGTTGTTGAACTGGACGAGCACAACGATGGT
CGACGTCTCCAGGAGACTTTAGCGGAACTGACAGGTGCCA
GAACAGTGCCAAGAGTTTTTATTAATGGACAGTGCATTGG
AGGAGGCTCAGATACTAAACAGCTCCACCAGCAAGGAAAA
CTTCTGCCTCTTATTGAACAGTGTAGGCCGTGCTGTTTAA
ATATGACACCTGAGGGCTCAGGAAATAGTCAAAATCAGCC
TCATCAGTGATGCTTTCTGTAGTGTGTATTATATATAAAC
ATGATGGTCACCTTTAAACAGCCTAAATACTAAATGTTTT
AAATGTATATGCTTCTGTATAAAAAAAAAAATACCTGCCT
GATTTAATGACAATTAATGAGTATTGTTATTTTGTTTATA
ATATTCCTGAACATTTGTTAGCCCAAGTACAGAAATGCAC
TGTATATATTCCTGTAAGATGTAACACCAGATAATAAAAG
TGTTTTTACTTTTACTTTTTAAGTTACAAAACCCCTGTAT
TTATGTAAAGTATATAAATACTTTTTTAAAATAATGTCAA
AAA

glrx2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA glrx2-201 1003
glrx2-202 (1) 575
glrx2-203 (1) 788
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
glrx2-201 Contained in:
[Fosmid] CH1073-390F18 (1) (order this)
OTHER glrx2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000045956 (1)
  • Ensembl_Trans:ENSDART00000162227 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC076178 (1) 877bp
    GenBank:EH536350 (1) 614bp
    CITATIONS (2)