header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-1175
Transcript Name: glrx2-203
Previous Name: glrx2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045957 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045957|OTTDARG00000032829|ZDB-GENE-040718-101 glrx2|OTTDARP00000036263 glrx2-002 LG_ FP928987.5 Danio rerio protein_coding KNOWN, 788 bp
AAATCAATGTTGTTCCGGTTGAGAGGTACGCGTGTGTTTT
GGACTTTGTTATGAAATAAAAGAAACGTCTTTCTTTACGT
GTAAAGCCGGTAATGATTTTGGACGGCCTTATTTATTAAG
CTACGCTCGACGTTATTTACACTCCACAATGTTTACGAGG
GGCTGTTTCTACAAATCCAGACAGGCTTATCAGAGTCTAA
GAATGGGGAACTTCTCGTCATCTGCGCCTGGGTTGTCAAG
CTCAGCTTGTGGTCAGTTTGTGCAGGATATTGTGTCCAGT
AACTGTGTTGTAATATTCTCCAAAACAACATGTCCTTACT
GTAAGATGGCAAAGGGTGTCTTTAATGAGATTGGAGCTAC
GTATAAAGTTGTTGAACTGGACGAGCACAACGATGGTCGA
CGTCTCCAGGAGACTTTAGCGGAACTGACAGGTGCCAGAA
CAGTGCCAAGAGTTTTTATTAATGGACAGTGCATTGGAGG
AGGCTCAGATACTAAACAGCTCCACCAGCAAGGAAAACTT
CTGCCTCTTATTGAACAGTGTAGGCCGTGCTGTTTAAATA
TGACACCTGAGGGCTCAGGAAATAGTCAAAATCAGCCTCA
TCAGTGATGCTTTCTGTAGTGTGTATTATATATAAACATG
ATGGTCACCTTTAAACAGCCTAAATACTAAATGTTTTAAA
TGTATATGCTTCTGTATAAAAAAAAAAATACCTGCCTGAT
TTAATGACAATTAATGAGTATTGTTATTTTGTTTATAATA
TTCCTGAACATTTGTTAGCCCAAGTACA

glrx2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA glrx2-201 (1) 1003
glrx2-202 (1) 575
glrx2-203 788
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
glrx2-203 Contained in:
[Fosmid] CH1073-390F18 (1) (order this)
OTHER glrx2-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000045957 (1)
  • Ensembl_Trans:ENSDART00000167996 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN508228 (1) 737bp
    GenBank:CB362136 (1) 508bp
    GenBank:CK687437 (1) 243bp
    GenBank:EB792095 (1) 238bp
    CITATIONS (2)