Transcript

glrx2-203

ID
ZDB-TSCRIPT-100915-1175
Name
glrx2-203
Previous Names
  • glrx2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045957 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045957|OTTDARG00000032829|ZDB-GENE-040718-101 glrx2|OTTDARP00000036263 glrx2-002 LG_ FP928987.5 Danio rerio protein_coding KNOWN, 788 bp
AAATCAATGTTGTTCCGGTTGAGAGGTACGCGTGTGTTTT
GGACTTTGTTATGAAATAAAAGAAACGTCTTTCTTTACGT
GTAAAGCCGGTAATGATTTTGGACGGCCTTATTTATTAAG
CTACGCTCGACGTTATTTACACTCCACAATGTTTACGAGG
GGCTGTTTCTACAAATCCAGACAGGCTTATCAGAGTCTAA
GAATGGGGAACTTCTCGTCATCTGCGCCTGGGTTGTCAAG
CTCAGCTTGTGGTCAGTTTGTGCAGGATATTGTGTCCAGT
AACTGTGTTGTAATATTCTCCAAAACAACATGTCCTTACT
GTAAGATGGCAAAGGGTGTCTTTAATGAGATTGGAGCTAC
GTATAAAGTTGTTGAACTGGACGAGCACAACGATGGTCGA
CGTCTCCAGGAGACTTTAGCGGAACTGACAGGTGCCAGAA
CAGTGCCAAGAGTTTTTATTAATGGACAGTGCATTGGAGG
AGGCTCAGATACTAAACAGCTCCACCAGCAAGGAAAACTT
CTGCCTCTTATTGAACAGTGTAGGCCGTGCTGTTTAAATA
TGACACCTGAGGGCTCAGGAAATAGTCAAAATCAGCCTCA
TCAGTGATGCTTTCTGTAGTGTGTATTATATATAAACATG
ATGGTCACCTTTAAACAGCCTAAATACTAAATGTTTTAAA
TGTATATGCTTCTGTATAAAAAAAAAAATACCTGCCTGAT
TTAATGACAATTAATGAGTATTGTTATTTTGTTTATAATA
TTCCTGAACATTTGTTAGCCCAAGTACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations