ZFIN ID: ZDB-TSCRIPT-100915-146
Transcript Name: glrx2-202
Previous Name: glrx2-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045958 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045958|OTTDARG00000032829|ZDB-GENE-040718-101 glrx2|OTTDARP00000036264 glrx2-003 LG_ FP928987.5 Danio rerio protein_coding KNOWN, 575 bp
GTGGACAGGCTGGATGAATATTTGGCAGACTCGTGAAGGG
CGGAGCTTGATACGTCAAATCAATGTTGTTCCGGTTGAGA
GAATGGGGAACTTCTCGTCATCTGCGCCTGGGTTGTCAAG
CTCAGCTTGTGGTCAGTTTGTGCAGGATATTGTGTCCAGT
AACTGTGTTGTAATATTCTCCAAAACAACATGTCCTTACT
GTAAGATGGCAAAGGGTGTCTTTAATGAGATTGGAGCTAC
GTATAAAGTTGTTGAACTGGACGAGCACAACGATGGTCGA
CGTCTCCAGGAGACTTTAGCGGAACTGACAGGTGCCAGAA
CAGTGCCAAGAGTTTTTATTAATGGACAGTGCATTGGAGG
AGGCTCAGATACTAAACAGCTCCACCAGCAAGGAAAACTT
CTGCCTCTTATTGAACAGTGTAGGCCGTGCTGTTTAAATA
TGACACCTGAGGGCTCAGGAAATAGTCAAAATCAGCCTCA
TCAGTGATGCTTTCTGTAGTGTGTATTATATATAAACATG
ATGGTCACCTTTAAACAGCCTAAATACTAAATGTTTTAAA
TGTATATGCTTCTGT

glrx2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA glrx2-201 (1)    Ensembl 1003
glrx2-202 575
glrx2-203 (1)    Ensembl 788
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
glrx2-202 Contained in:
[BAC] CH73-13N19 (1)
[Fosmid] CH1073-390F18 (1)

Genome Resources: Vega_Trans:OTTDART00000045958 (1),  Ensembl_Trans:ENSDART00000163980 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH552215 (1) 621 nt
CITATIONS (2)