Transcript

glrx2-202

ID
ZDB-TSCRIPT-100915-146
Name
glrx2-202
Previous Names
  • glrx2-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045958 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045958|OTTDARG00000032829|ZDB-GENE-040718-101 glrx2|OTTDARP00000036264 glrx2-003 LG_ FP928987.5 Danio rerio protein_coding KNOWN, 575 bp
GTGGACAGGCTGGATGAATATTTGGCAGACTCGTGAAGGG
CGGAGCTTGATACGTCAAATCAATGTTGTTCCGGTTGAGA
GAATGGGGAACTTCTCGTCATCTGCGCCTGGGTTGTCAAG
CTCAGCTTGTGGTCAGTTTGTGCAGGATATTGTGTCCAGT
AACTGTGTTGTAATATTCTCCAAAACAACATGTCCTTACT
GTAAGATGGCAAAGGGTGTCTTTAATGAGATTGGAGCTAC
GTATAAAGTTGTTGAACTGGACGAGCACAACGATGGTCGA
CGTCTCCAGGAGACTTTAGCGGAACTGACAGGTGCCAGAA
CAGTGCCAAGAGTTTTTATTAATGGACAGTGCATTGGAGG
AGGCTCAGATACTAAACAGCTCCACCAGCAAGGAAAACTT
CTGCCTCTTATTGAACAGTGTAGGCCGTGCTGTTTAAATA
TGACACCTGAGGGCTCAGGAAATAGTCAAAATCAGCCTCA
TCAGTGATGCTTTCTGTAGTGTGTATTATATATAAACATG
ATGGTCACCTTTAAACAGCCTAAATACTAAATGTTTTAAA
TGTATATGCTTCTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations