Transcript

psmb8a-201

ID
ZDB-TSCRIPT-100915-617
Name
psmb8a-201
Previous Names
  • psmb8a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045144 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045144|OTTDARG00000032335|ZDB-GENE-990415-141 psmb8a|OTTDARP00000035685 psmb8-001 LG_ FP074889.10 Danio rerio protein_coding KNOWN, 1226 bp
AACCCATCTGCAGAGTTTTCCCTCAGACAATCACTAAGTT
ATCATGTTGTTTGTAGATACTCTTAAACAACATTTAATAA
CCTAAAAGACAACATTTATGTACACCTGTTATTCAAAGAT
ATAGATTATGCTTTTAGTTTGTTTTTAAAGATACTTTCTG
GTCGTTATCGAAACCAAATTAAGCTTCTCTGAATCTTTCG
GTTTCGAAATCGTTGTCTTCCGTGCATGGATCGTATTTCC
TTCATGTAAAATAGCCTAATACACTTTGGTTACTTCGCTT
TTAGTGTTTTAATTACTGCCATTAGCTGTGCGTAACATAC
AGGATGGCTCTTTTGGACGTAAGTGGATATAAATATAATT
CCGCCTCACAGTTTGGCTTTAAACAAACGCTTCTCGACCG
CTCGAATCACTACAGTTTTGGGACCAAATGTCAGGAATTC
GCGGTACCTGTTGGAGTTGACCCCTCCAAGTTTCTCAAAT
CGTGTAGTTGTGAAGATGGCGTTTGCATAGATCTGAATCA
TGGCACCACAACACTGGCATTCAAATTCCGTCATGGAGTC
ATTGTGGCTGTAGACTCCAGAGCTTCAGCTGGAAAATATA
TTGCATCAAAGGAGGCCAATAAAGTGATTGAGATCAACCC
TTACCTGCTGGGCACCATGTCGGGCAGCGCTGCAGACTGT
CAGTACTGGGAGAGACTCCTGGCTAAAGAGTGCAGACTTT
ATAAACTACGCAACAAGCAGAGGATCTCAGTGTCTGCAGC
CTCCAAACTGCTCTCCAACATGATGCTGGGATACAGAGGC
ATGGGCCTGTCTATGGGGAGCATGATCTGCGGATGGGACA
AACAGGGTCCAGGCCTGTACTATGTGGACGACAATGGCAC
TCGTCTGTCTGGTCGGATGTTTTCCACCGGCTGTGGGAAC
AGTTATGCGTATGGTGTGGTGGACAGTGGTTATCGTGAGG
ATATGACTGTGGAGGAGGCGTATGAACTGGGCCGTCGTGG
CATCGCTCACGCCACACATAGAGACGCCTATTCTGGTGGT
GTCGTCAACTTGTACCACATGCAGGAGGACGGCTGGATCA
AGGTGTGTAAGGAGGACGTGTCAGAGCTGATCCACCGCTA
CAAGAAGGGGATGTTCTGAACATATCGGATCTCATGTTCA
TGCAAATCTCACTGTTTTAATATTAAATCTGGCACAGTAC
AAAATTAAACTGTTCTCAAATCAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations