Transcript

ottdart00000002444

ID
ZDB-TSCRIPT-090929-23259
Name
ottdart00000002444
Previous Names
None
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002444 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002444|OTTDARG00000002259|ZDB-GENE-990415-141 psmb8a|OTTDARP00000002167 psmb8-001 LG_ AL672164.13 Danio rerio protein_coding KNOWN, 1174 bp
TTCTAGATACTCTTAAACAACATTTAATACCCTAAAGGAC
AACATTTATGTACACCTGTTATTTAAAGATAAAGATTATG
CTTTTAGTTTCTTTTTAAAGATACTTTCTGGTCGTTATCG
AAACCAAATTAAGCTTCTCTGAATCTTTCGGTTTCGAAAT
CGTTGTCTTCCGTGCATAGATCGTATTTCCTTCATGTAAA
ATAGCCTAATACACTTTGCTTACTTCGCTTTTAGTGTTTT
AATTACTGCCATTAGCTGTGCGTAACATACAGGATGGCTC
TTTTGGACGTAAGTGGATATAAATATAATTCCGCCTCACA
GTTTGGCTTTAAACAAACGCTTCTCGACCGCTCGAATCAC
TACAGTTTTGGGACCAAATGTCAGGAATTCGCGGTACCTG
TTGGAGTTGACCCCTCCAAGTTTCTGAAATCGTGTAGTTG
TGAAGATGGCGTTTGCATAGATCTGAATCATGGCACCACA
ACACTGGCATTCAAATTCCGTCATGGAGTCATTGTGGCTG
TAGACTCCAGAGCTTCTGCTGGAAAATACATTGCATCAAA
GGAGGCCAATAAAGTGATTGAGATCAACCCTTACCTGCTG
GGCACCATGTCGGGCAGCGCTGCAGACTGTCAGTACTGGG
AGAGACTCCTGGCTAAAGAGTGCAGACTTTACAAGCTACG
TAACAAGCAGAGGATCTCAGTGTCTGCAGCCTCCAAACTG
CTGTCCAACATGATGCTGGGATACAGAGGCATGGGCCTGT
CTATGGGGAGCATGATCTGCGGATGGGACAAACAGGGTCC
AGGCCTGTACTATGTGGATGACAATGGCACTCGTCTGTCT
GGCCGGATGTTTTCCACCGGCTGTGGGAACAGTTATGCGT
ATGGTGTGGTGGACAGCGGTTATCGTGAGGATATGACTGT
AGAGGAGGCATATGAACTCGGCCGTCGTGGCATCGCTCAC
GCCACACATAGAGACGCCTATTCTGGTGGTGTCGTCAACC
TGTACCACATGCAGGAGGATGGCTGGATCAAGGTGTGTAA
GGAGGACGTGTCAGAGCTCATCCACCGATATAAGAAGGGG
ATGTTCTGAACACATGGGATCTCACGTTTATGCAAATCTC
AATGTTTTATTATTGAATCTGGCACAGTACAAAATTAAAC
TGTTCTCAAATCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations