Transcript

psmb8a-202

ID
ZDB-TSCRIPT-100915-105
Name
psmb8a-202
Previous Names
  • psmb8-003
  • psmb8a-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045146 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045146|OTTDARG00000032335|ZDB-GENE-990415-141 psmb8a|OTTDARP00000041878 psmb8-002 LG_ FP074889.10 Danio rerio protein_coding KNOWN, 638 bp
GTCTTAATGTATAACGACAACACAAAAACAATACAGTTTG
GAGATGAAGGCATGGGCATTGGCTTTGCTTGCAGCCTCCT
TCACTCTTTCCATTGAGCAGCCTTGGAGACCATAGCCAAT
GTTGTCTCGTACTGTACCAGAGAAAAGGACAGGCTCCTGA
CCCACCATCGCTACCTGAGAGAGATTTATTTGCAGATCCA
TTAATTGATTGATATTTGTGTTGGTAGTCCTGCAGTGGTT
TTCCATCTAACAGAATGGTTCCCTGCTGCGGCTGGTAGAA
TCTCTCCAGCAGACTCACACAGGTGCTCTTCCCTCCACCG
GACATTCCCACCAGAGCCGTCATCTGACCCGGCTTCAACT
CCAGAGAGAAGTCCTGGAAATGTGAATGGTTATGCCCTCC
AAGTTTCTCAAATCGTGTAGTTGTGAAGATGGCGTTTGCA
TAGATCTGAATCATGGCACCACAACACTGGCATTCAAATT
CCGTCATGGAGTCATTGTGGCTGTAGACTCCAGAGCTTCA
GCTGGAAAATATATTGCATCAAAGGAGGCCAATAAAGTGA
TTGAGATCAACCCTTACCTGCTGGGCACCATGTCGGGCAG
CGCTGCAGACTGTCAGTACTGGGAGAGACTCCTGGCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations