Transcript

rxrba-201

ID
ZDB-TSCRIPT-100915-611
Name
rxrba-201
Previous Names
  • rxrba-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045126 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045126|OTTDARG00000031779|ZDB-GENE-980526-436 rxrba|OTTDARP00000035675 rxrba-004 LG_none FP101875.6,FP085394.7 Danio rerio protein_coding KNOWN, 2294 bp
GGGTTAATGCTGCTGTTGTTTACATTTCCCGACAGGGATC
ACTTCGGTTGGTAAAAGATCCAAAGGCCCGGGCCTCAGTC
CGCGGTCTTGAGTTCGACAGCCACCCGACATCAGAGCGAG
AGAGTCGGTGTGAACAGCAGAGCCCGGCTGCACAACATGG
GCGACAGCAGAGATTCTCGTAGTCCAGACAGTTCATCCGT
TTCCTCACCACCATCAGGTCAGCGTTCGCCCCCGTTGGCC
CCGTCAGCTGCCGCCATGACTTCTCTCCCACCCATCACTT
CGGCTGTGAACAGCCCCATCAGCAGCATGGGCTCACCCTT
CTCGGTCATCAGCTCATCCCTGGGGTCTCCTTGCCTTCCT
GGAACTCCCTCGGTGGGCTACGGCCCCATCAGCAGCCCAC
AGATCAACTCCACCGTGTCCATGTCAGGTCTGCATGCCGT
CAGCAGCTCCGATGACGTGAAGCCACCCTTTGGTTTGAAG
CCGCTGTCCTCTCACAGTCCAGGACCCATGGTTTCACAGA
AACGCCTGTGTGCCATCTGTGGAGACCGCTCCTCTGGCAA
GCACTATGGAGTGTACAGCTGCGAGGGCTGCAAGGGCTTT
TTCAAGCGCACTGTGAGGAAGGACCTTAGCTACACATGCA
GAGACAATAAAGACTGTCTGGTGGACAAGCGCCAGAGGAA
CCGCTGCCAGTACTGCCGCTACCAGAAGTGCCTGGCCATG
GGGATGAAGAGAGAAGTGGTCCAAGATGAACGACAACGAT
CCGTTCAGGAGGAGCGTCAGAGAAACAAAGAGCGCGATGG
AGAGGTGGAGTCCTCCAGCGCTGCCAATGAGGAGATGCCC
GTGGAGAAGATTCTGGAGGCAGAGATGGCTGTAGAGCAGA
AGACTGAGCTGCATGCTGATGGCAGCTCAGGGGGAAGCTC
TCCGAACGACCCGGTCACAAACATCTGCCAGGCCGCTGAT
AAACAGCTGTTCACTTTGGTGGAGTGGGCCAAACGGATCC
CTCACTTCAGTGAGCTCTCTCTGGACGACCAGGTCATCCT
GCTGCGTGCCGGCTGGAATGAACTGCTGATCGCATCATTC
TCTCATCGCTCCATCACAGTGAAGGATGGCATTCTGCTGG
CCACCGGTCTCCATGTGCACAGGAACAGTGCTCACAGCGC
TGGGGTGGGAGCCATCTTTGACAGGGAGAGTGCGCACAAT
GCAGAGGTTGGGGCCATATTCGACAGGGTGCTGACCGAGC
TGGTGAGCAAAATGAGGGACATGCAGATGGATAAAACGGA
GCTGGGATGCCTCAGAGCCATCATCCTATTCAACCCAGAT
GCAAAGGGATTGTCAAGCCCAAGTGAAGTGGAGTTACTAA
GAGAGAAGGTCTATGCATCGCTGGAGGCCTATTGTAAACA
GAGATATCCTGACCAGCAGGGAAGGTTTGCAAAGCTTCTT
CTCCGGTTGCCAGCATTGCGCTCCATTGGCCTCAAGTGCC
TGGAGCACCTGTTCTTCTTCAAGCTGATTGGAGACACCCC
AATCGACACCTTCTTAATGGAAATGCTTGAAGCGCCTCAT
CAGCTGACCTAACCTGGACCAGTCTCGATCCAATTCAATC
CGGTTTGCACCAGGGTATCGCAGTACCCCCTGGACTCTGG
GGCTTTACTGTGTCTCACTTCCCAATAACACCTCCCCCCC
CCCACAATCCTCTCCTCCACATTCTCCCTGCCGCACCTTC
AAACCAGTACAGCCACAAAAAAGACTCTTAAGCTGTCTGA
AAAAAAAGAGATGTTTTCCATGTAACGTTTTACACCGTAT
GAGCTGTCCAGAGAGATCTTATTTTTTCGAATTCCCTGGA
GGGTCTAAATCAAAAGCTTTGTTTTAAAGACTTCAGCTTC
CAGTTTTAGAACTCTCGTATTGATTCTAGAGATCTCAGTG
TGTCGTTTTGGTTTCTATGTTACTCTGAATGCACGAACTG
TACTTTTTTCTTTTGTTTTGTTTTTGGGGTCACTGCAGTT
AGACAGCCCTTCGGCTGAATTTACAGTGCATGTGTGACTG
GGGTGAGAATCCGGCAAGCCTTTTGGCTGGTACGAATCAA
GTCGCGGCAGGCCTGACCCTTTGTGTTTGACTGTGGAAAA
CTGCTAACATGCTATTTTTGGGATTTTTACATTGAGATCC
CACTTTGTACTGTACTCATGAAATGAGTCCAATTTATAAA
AGGCATTGGAAATTCTTGGCCTGCTGCATCTGGCCCATAT
GAAATGCAGGCCGGGGTTTTACATTTGTGAATAAATGTAT
GGAGGTTTTGTTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations