Transcript

rxrba-002

ID
ZDB-TSCRIPT-100915-1092
Name
rxrba-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044285 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044285|OTTDARG00000031779|ZDB-GENE-980526-436 rxrba|no_translation rxrba-002 LG_none FP101875.6,FP085394.7 Danio rerio protein_coding KNOWN, 568 bp
GGGTCATGGAAGAAGGAATGTTGCTGGAGGACTTTGAATG
TGTGCGTGTGTGTGAATGAATGTGTTGAAAACTAACCAGG
AACTACATGTATCTGTATATCTCTGTGTCTCTCTACATCT
GTTTCCATCTTTACCGCTTTACCCATTCATCCCCCTCCCC
TTTCACGTTCTTTTTTCCCCCGTTATGTTGGTCTTTCTCA
CACTATCCTGCACTCTGCCCTTCATCTTCGTTTCCCCGTC
TTGTTCCTCTTCCTCATTTCCCTGTGTGCGATGCAGCCGT
TCAGGAGGAGCGTCAGAGAAACAAAGAGCGCGATGGAGAG
GTGGAGTCCTCCAGCGCTGCCAATGAGGAGATGCCCGTGG
AGAAGATTCTGGAGGCAGAGATGGCTGTAGAGCAGAAGAC
TGAGCTGCATGCTGATGGCAGCTCAGGGGGAAGCTCTCCG
AACGACCCGGTCACAAACATCTGCCAGGCCGCTGATAAAC
AGCTGTTCACTTTGGTGGAGTGGGCCAAACGGATCCCTCA
CTTCAGTGAGCTCTCTCTGGACGACCAGGTCATCCTGCTG
CGTGCCGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations