Transcript

rxrba-204

ID
ZDB-TSCRIPT-100915-1126
Name
rxrba-204
Previous Names
  • rxrba-005
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045127 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045127|OTTDARG00000031779|ZDB-GENE-980526-436 rxrba|OTTDARP00000035676 rxrba-005 LG_none FP101875.6,FP085394.7 Danio rerio protein_coding KNOWN, 940 bp
GGGTTAATGCTGCTGTTGTTTACATTTCCCGACAGGGATC
ACTTCGGTTGGTAAAAGATCCAAAGGCCCGGGCCTCAGTC
CGCGGTCTTGAGTTCGACAGCCACCCGACATCAGAGCGAG
AGAGTCGGTGTGAACAGCAGAGCCCGGCTGCACAACATGG
GCGACAGCAGAGATTCTCGTAGTCCAGACAGTTCATCCGT
TTCCTCACCACCATCAGGTCAGCGTTCGCCCCCGTTGGCC
CCGTCAGCTGCCGCCATGACTTCTCTCCCACCCATCACTT
CGGCTGTGAACAGCCCCATCAGCAGCATGGGCTCACCCTT
CTCGGTCATCAGCTCATCCCTGGGGTCTCCTTGCCTTCCT
GGAACTCCCTCGGTGGGCTACGGCCCCATCAGCAGCCCAC
AGATGAACATGTTTCCCAGAAACGCAGAGATCAACTCCAC
CGTGTCCATGTCAGGTCTGCATGCCGTCAGCAGCTCCGAT
GACGTGAAGCCACCCTTTGGTTTGAAGCCGCTGTCCTCTC
ACAGTCCAGGACCCATGGTTTCACAGAAACGCCTGTGTGC
CATCTGTGGAGACCGCTCCTCTGGCAAGCACTATGGAGTG
TACAGCTGCGAGGGCTGCAAGGGCTTTTTCAAGCGCACTG
TGAGGAAGGACCTTAGCTACACATGCAGAGACAATAAAGA
CTGTCTGGTGGACAAGCGCCAGAGGAACCGCTGCCAGTAC
TGCCGCTACCAGAAGTGCCTGGCCATGGGGATGAAGAGAG
AAGTGGTCCAAGATGAACGACAACGATCCGTTCAGGAGGA
GCGTCAGAGAAACAAAGAGCGCGATGGAGAGGTGGAGTCC
TCCAGCGCTGCCAATGAGGAGATGCCCGTGGAGAAGATTC
TGGAGGCAGAGATGGCTGTAGAGCAGAAGACTGAGCTGCA
TGCTGATGGCAGCTCAGGGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations