header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-208
Transcript Name: myh14-203
Previous Names: myh14-001, ch211-120k19.2-001, si:ch211-120k19.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046197 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046197|OTTDARG00000032971|ZDB-GENE-100921-1 myh14|OTTDARP00000036458 myh14-001 LG_ AL929505.14 Danio rerio protein_coding KNOWN, 12826 bp
TTTGCCATCAGTTTGCTTTACCGTCTATTTTATTCTCAGT
GTGAATGAGTTTGCGGCTTCACGGGAGCGCTGTAATGTGA
AAAGCCGCATTTGCACTATTAGTATCCCAACACTGGAAGG
AAAAACACGAGGGCCGTTTTAATTCTCCTCACAGCTCTAG
TCTTATCCCGAGAGTGGATTAACACATTTAAGCGCTACAA
CCATGTCCAGGCCAGCGGGGGGCAGTATTAATGATGTCGC
CTGCTTCCTGTCTACGGGGGCGGGGCCTGGGTCACCAACC
TCAGTGTTCTCCGCCTCCAGCCAAGCTGATTGGGCGGCTA
AGAGACTTGTATGGGTGCCTTCAGAGAAACATGGGTTTGA
GTCTGCCAGCATTCGCGAGGAGCGGGGCGATGAGGTGGAG
GTGGAGCTTACAGACAGTGGGCGGAAACTAACACTTCTGA
GGGAGGAGCTTCAGCGGATGAACCCTCCCCGATTCAGTAA
AGTTGAAGACATGGCCGATCTCACATGCCTCAATGAAGCC
TCCGTCTTACACAACCTACGAGAGAGATACTATTCAGGAC
TTATATATACATACTCTGGCCTGTTTTGCGTGGTGATCAA
CCCCTATAAGAACCTGCCCATCTACACAGAATCCATTATA
GAGATGTACCGTGGCAAGAAACGACATGAGATGCCTCCTC
ATATCTATGCCATATCGGAGGCGGCGTACAGGAGCATGCT
GCAAGACCGAGAAGATCAGTCTATCCTCTGCACAGGGGAA
TCCGGTGCAGGAAAAACAGAAAACACCAAAAAAGTGATTC
AGTATTTGGCACATGTGGCATCTTCACACAAGTCTGGTAC
TCTGGGGCGACCCAAAGACACTGTTGTACAGACCGTGCAG
TATGGGGAGCTGGAAAGACAGTTACTGCAAGCAAACCCCA
TTCTTGAGGCCTTCGGCAACGCCAAGACTGTCAAAAACGA
TAACTCTTCCAGATTTGGCAAATTCATCAGAATCAATTTT
GATGTTGCTGGATATATTGTTGGTGCTAATATTGAGACTT
ATCTGCTAGAGAAGTCTCGAGCCATTCGTCAGGCTAAAGA
TGAGCGAACCTTCCATATCTTCTACCAGCTTCTCTCTGGT
GCAACTGAGGCCATGAGAAAGGAGCTTTTGCTGGGAGGTG
CAGATCAATATCGTTTCCTCTGTGGAGGTTCACTTCCTGT
TCCGGGTCAAAGTGATTCAGAAAACTTCACTCAGACAATG
GACTCGATGACCATCATGGGCTTCACCCAGGAAGAATCTA
CATCCATGCTAAAGGTGATCTCTTCAGTGCTGCAGTTTGG
GAACATCACATTTCACAAAGAGAAGAACACGGATCAGGCC
TCAATGCCAGATGACACCGCAGCACAGAAACTCTGCCACC
TGCTGGGCATCAGCGTGCTGGAGTTTAGCCGTGCCATTCT
CACTCCTCGCATCAAAGTAGGCCGCGAATATGTCCAGAAG
GCCCAGACCAAGCAGCAGGCTGATTTTGCCGTGGAAGCTT
TAGCAAAGGCCACATATGAGCGTCTGTTTCGCTGGCTTGT
GCATCGGATCAATAGAGCTCTAGACCGCAGACAACGTCAA
GGAGCCTCGTTCATCGGCATTCTGGACATTGCTGGATTTG
AGATCTTCCAGCTGAACTCATTCGAACAGTTGTGCATCAA
CTACACTAATGAGAAACTGCAGCAACTCTTTAATCACACC
ATGTTTGTGCTGGAGCAAGAAGAGTATCAGCGAGAGGGCA
TTGAGTGGAACTTTATCGACTTTGGTCTGGATCTTCAACC
CTGTATCGACCTCATTGAAAGACCGGCTCATCCTCCTGGT
GTGTTGGCATTGTTGGACGAGGAGTGTTGGTTTCCAAGAG
CAACTGATCGCTCATTTGTGGACAAGCTGTCAGCTGAGCA
GGGTTCACATTCAAAGTTCATGCGGCCCCGGCAGCTGAAA
GAAGAGGCAGACTTCTCTATTATACACTATGCTGGCAAGG
TGGATTATAAAGCAAAAGAGTGGCTGGTGAAGAACATGGA
TCCCTTGAATGATAATGTTGCATCTCTCCTGCATCAGTCA
TCTGACCCCTTCATCTCTGAGCTCTGGAGGGAGGTGGAGA
GGATTGTAGGTCTGGATCAGGTGTCCTCAGGTGAGAACAG
TGGACCGGTGAGTTTTGGGGCTGCTGGACTCAAGACGAAG
AAGGGCATGTTCCGCACAGTGGGCCAACTCTACAAGGAGT
CCCTCACTAAACTGATGGCCACCCTCCGCAACACCAATCC
TAACTTCCTGCGCTGCATCATTCCCAACCATGAGAAAAGG
GCTGGAAAGTTGAGTCCTCATTTGGTTCTGGATCAGCTAA
GGTGTAACGGGGTGCTGGAGGGGATCAGGATCTGCAGGCA
GGGCTTCCCGAACCGCATCCCTTTCCAGGAGTTTAGGCAA
AGGTATGAGATCCTGACTCCAAATGCTATTCCTCGAACCT
TTATGGATGGCAAACATGCATCTGAGCTCATGATCAGTGC
TTTAGAGTTGGACAAGAATCTTTTTCGGGTGGGACAGAGT
AAGGTGTTCTTCAGGGCTGGAGTTTTAGCTCATCTGGAGG
AAGAACGAGACTTGAAGATCACTGACACCATTATCCGCTT
CCAGAGCGCAGCTCGTGGATACCTTGCTAGAAAGGCATTC
CATAAGAAGCAGCAGCAGCTTAGTGCTCTGCGGGTGATGC
AGAGAAATTGTGCTGCATATCTGAAGCTCAGAAACTGGCA
GTGGTGGAGACTCTTCACCAAGGTGAAGCCCTTGTTGCAG
GTGACCCGTCAGGATGAAGAGATTCAAGCTCGGGAAGCAC
AGCTTCAGAAAGCCAAAGACAAGCTGAGTAAACTAGAGCT
TGACTTTACTGAACTGGACAAGAAAAACCAACAGCTGATT
GAGGAGAAGTCAGTCTTGACCGACCAGCTGCAGGCCGAGG
CAGAGTTATTCGCGGAAGCAGAGGAAATGAGAGCACGGCT
GGCCAATCGCAAACAGGAGCTTGAAGATGTGTTGGGGGAG
CTTGAGAGCCGATTGGAGGAGGAAGAAGAGAGGACTGTTC
AGCTGACCAATGAGAAGAAGAGGATCCAGCAACATGTGCA
GGATCTTGAAGAACAGCTAGAGGAGGAAGAAGGGACACGT
CAGCGCCTCCAGCTGGAGAAAGTTACCCTGGAAAGCAAAG
TGAAGAGTCTGGAAGCAGAGACCTTGACTTTGGCTGAGCA
GAGGGACAGATTAAGCAAGGAGAAGAAACAGCTGGAAGAA
AGACTGAATGAAGTGACAGATCAGCTCACAGAGGAAGAGG
AGAAGGTGAAGAGTCTCAACAAGCTGAAAAACAAGCAGGA
AGCTGTCATCGCTGATATAGAAGAGCGTCTGAAAAGGGAA
GAGCAGGGTCGTCTGGAACAGGAGAAGTGGAAGCGGCGAA
TGGAAGGAGAAGCAGTGGAGGCTCAAGAGCAGCTATCTGA
CATGAGCTTACTCGTCACTGAGCTGAGAGGAAGCCTGAGC
CAGAGAGAAAAAGAGATCACCACATTACAGACAAGGCTGG
AAGAAGAGGGGGCACGTCGGACAGAAGCTCAGAGAGCCCT
GAGAGAGGCCATGTCTCAGGTCTCTGAGCTCAAAGAGGAG
GTGGAGAATGAACGAGGGATGAGGGAAAGAGCTGAAAAAC
AGAGAAGAGATCTTGGAGAGGAGTTAGAAGCTTTGAGGAC
TGAGCTGGAAGATACTTTGGACACTACTGCTGCTCAGCAA
GAACTCAGGTCTCGTCGTGAGGCTGAGTTAGGAGAGCTTC
AGAGATGTTTAGAGGAAGAAACTCGTCGTCATGAAGCCCA
GCTGTCAGAGCTCCGCATCAAACACACCGCTGCTATAGAC
TCACTTCAGGAGCAACTCGACAACGCCAAAAGATCCCGTC
AGTCACTGGAGAAGGCAAAAGCTGTTCTGGAGGAGGAGCG
CTTGAATCTGAGTGCTGAACTGAAGACATTACAAGGAGGG
AAGATGGAGAGCGAAAGGGGCAGAAAAAGAGCGGAAGGAC
AGTTGCAAGAACTCAACGCACGCCTCTCGCAGGCAGAGAG
AGAAAGAGAAGAGCGAGAGGAACGTCTTGGTAAACTCCAG
TCAGAGCTTGAGTCTCTGTCCAGCTCCCTCTCCTCATCTG
ACTCCAAATCTCACCGCCTTCATAAAGAGGTCAGCAGCCT
GGAGAGCCAACTGCATGATGTGCAGGAGCTACTACAGGAA
GAGACACGGCAGAAGTTGGCACTTGGTTCACGTGTACGTG
CTCTTGAGGAGGAGAAAGCTGGACTGATGGAGAGATTAGA
GGAGGAGGAGGAGAAGACTAGGGAACTTACACGCCAGATT
CAGAACCATACACAACAGCTGGCTGATCTGAAGAGGCAGA
CAGAGGAGGTCAATTCAGCAGTGGAGGCTGGGGAGGAGAC
CAGGAGAAAGATGCAGAGAGATTTGGAGAATGCCGTACAG
AGGGAGAAATCCAAAGAAGAGGAGAAAGAGCGCATAGAGA
GACAGAAAGAACGGCTGAGAGAGGAGATAGAGGACATGAC
CATCGCTCTGCAGAGAGAGAGACAGAACTGCACTGCTCTG
GAGAAGAGACAGAAGAAATTTGATCAGTGTTTGGCCGAAG
AGAAGGCAGTGAGTGCCCGGCTGCAGGAGGAACGTGACCG
TGCTGAAGCAGAAAGTCGAGAGAAAGAGACGCGCTTCCTG
TCTCTCTCTAGAGCATTGCAGGAAGCAACAGAGCAGAGAG
ATGAACTGGAAAGAACCAATAAGCAGCTTCGCCTGGAGAT
GGAGCAGCTAGTCAATGCCCAAGATGATGTCGGCAAAAAT
GTTCATGAGCTGGAGCGTTCTCGGCGGGCTTTGGAAACAG
AAGCACAGTCTTTAAAAGAACAAACGCAGGAGTTAGAAGA
TGAGTTGGGAGAGGCAGAGAACGCTCGCCTCAGATTGGAG
GTCACACTTCAGGCTCTTAGAGCTCAGTTTGAAAGAGAGA
TCAGCACTAAGGAGGAGAAAGGAGAAGAAAAGAGGAGGGC
ACTCAACAAGCAGGTACGAGAGCTTGAAACAATGCTTGAG
GAGGAGAAGACTCAAAGAGCTCAGGCTTTGACTGTTAAGA
AACAACTGGAGACAGAGCTGCAGGAGGCAGAGGCTCAGGT
GGAAGCAGCCAATCGGGGCAGAGAGGAAGCATTTCGCCAG
ATGAAACGTCTCCAGACTCAGATGAAGGAGCTTATTCGTG
AGCTTGACGAAACCAAGTTGGCTCGAGATGAGATTGTTGC
CCAATCAAAGGACAGCGAAAAGCGTCTGCAGACATTGGAG
GCAGAACTATTGCAGCTGACAGAGGATCTATCTGTTTCTG
AGAGGCAGAAGAGGCAAGCCCAGCAGGAAAGAGATGAAAT
GGCAGATGAAATCATCAACAATGCAACTGGAAAATCTGCT
CTATTTGATGAGAAGCGGCGCCTTGAAACTAGAATCACTC
AGATGGAGGAAGAATTAGAAGAGGCACAGAGTAATGCTGA
ACTATTAGCCGAGAGGCAGAGGAAGAGCACCCTACAGATT
GAAACACTTACAGTCCAGTTATCTGGAGAGAGGACACTAG
CGCAGAAGAGTGAAAGTGCACGAGAGACTCTGGAGAGGCA
GAATAAAGAGTTAAAGACTCGCCTTAGTGAGATGGAAGGA
GCTGTGAAGGGGAAACATCGCCTCAGCGTCGCCGCCCTGG
AGGCTAAGATTGAATCCATGGAGGAACAAGTGGAGCAAGA
AAGACAAGAGCGAGCCATGGCCAATAAGCTGGTGAGGAAA
ACAGAGAAGAAACTGAAAGAAGTTTTGATGCAAGTGGAGG
ATGAAAGAAGGCATGCAGATCAATACAGAGAGCAGTTGGA
TAAGTCTATGGGGCGCCTCCGTCAACTGAAGAGGCAGCTA
GAGGAGGTAGAAGAAGAGAACTCTCGCTCCAATGCCCAGC
GCAGGAAACTACAGCGAGAGCTGGAGGAAATGAGCGACAG
CATGCAGAGCATGAACCGCGAGCTCAACACTCTCCGCTCC
CAACTCAGCATCACAGAACGCCAGAAGTCAGAACAGAGAG
CTCCGCTCCCTCTGTCCATGCGTGCTGGTCGCAGAGCTCT
AGTTGATGACCTTTCTCAGGAGAACTCTGATTCTGAAGAT
CCAGGTGCTTCTCCCACACCGTCCAGCGGCCCACCGGGTA
CCCCCACACCCTCAGACAACGCCCTGGGCCCCCCTCCCCC
GTACAGCCTTACAGATGCTGAATAAGAAGGGGCGAGATGG
ACAATTTTACTGGTTTAACTCGCATAGCTTTTGCAATCGT
ACCCATAACAGAACATCAGTGCAGTCACACATAACTTGAA
ACTAGTTGATGTGATTTATCGATTTTAAATGAACTGACAA
ATTAGCATGCAAGATGGAGAAAGATTATTGTACTATAGAA
ATCAAGTAAGCAGTGAGTAAGGACTGCAGAAGTGAAAATC
ACATTTCCCAGCATTCCTCGGGAAATGAAGTACTGTATAT
CGATGCAGTATATCAGGCTTGTTGTGGCAGAATTGTGATG
GCCACCTCAAGCTCGATTTCAATCAATTTAAAGCCATGTG
TTTAGGTGAAATTTGCATGTGGGTGGCAATCAGAAGCCAT
CCGGGTTTACACAGATGATCCACAATCAGGCTAGAATGTG
TCATCTGTGCTCGCACAAGCCATCAAATCCTCAAAGCACT
GAGAAACTTTCTCTCACTCCTGAAACAATATCATGCTTAA
AGACATTGAGAACTGAACAAGAATATCTCTTTGGTATTTT
AAAATATCAGTGTTTTAACATTTTAGAGGTGGTAGTGTGA
CTTAATACATAGAAAATAATGCTTTTTGCTAAACGTGATT
TGGCAGAGATGATGTTTACGGAAGCCCATTTTTCCCCTAG
AGTAATAGAATAACAAAAGTAATTGGGGATTTATATCACA
AATTTGCGTTATTATATCATCAGTGTTGTGATTTTACAAC
TCTCAGTTGTAAGAAACAAACTTTATATCTTTATCGTTCT
CAATATCGTGACTGTATGTCACAAGTTTATTTCAGTTGTG
ACTTTAAGTCTCACCATTACAGCTTTTGCAGTATTGTAAC
TTTACATCTCAGAATTTTAATCATGCTAATTGCAACTTCA
CAATTGCGACAGTCCCAAAATTGTGATTTTATTACTTGAA
ATGCAAGTTTGCTTTTTGCAATTGTGACTTTATTACTGAG
GGTGTGACTTTATATCTCACAGTTGCATATTTCCTTTTCA
AAATTTTAATATTTACATCTCGTAGATATAGACTTGTTTG
TCTTAAATGTGACTTTAGAACTCACAATTGTGACTTTCTC
AGTAACCTCATTTTACAACTGCAAGTTTGTTTCTTGCAAC
TGTGACTTTATATCTCACTGTGTGAGTTTTTATATCGGAA
TTACTCTTTCTCTAAATGGTGATTTTAACTCTTGCAATTG
GATGTTTGTTTCTCGCAATTGTGACTTTATAACATACAGT
GTGACTATATCTCACAATCACACCTTTCTAAGTGTAGTAA
TTTGACACGTTCCAATTTAAGGGTTTGTTCTTGCTATTTG
CGGCTCAGAGTGTGACTTTATATCTCACAGTTGTGACATT
CTCAATATTGTAATTTTACATCTTTGAATCTCTTGCAGTA
ATAGCTCTAACTTGTAGTGTAACTTTATATCTCATCATTG
CCACCTTGCTTTTCAATATTGTGATTTTCCATCTAACAAA
TATAAGGAAGCATTTACACTAGTGCATTTTTGTTTTTAAA
ATTGCATTTTAGATCCAGACTGGTGTTTTCATTGCAATTT
TAATCTCCATCCATGCTATATATATACAAATATATATATT
GCTGCTTGTTCAAACTACTTATTTAAAATGATCTGAAACA
AAACAGTTATTTAGATTATTTGCAACAATTAAAAGTGTTT
TCACACTAGTTTTGGTCCGCACCCGGATTAATTTGACATA
AGAGTATGGTACTTTTAGCTAGTGTGAACGCTGTTTTCTG
AATGTACGTACTTTTTTAACGGCTGAGTAGTATGTTTAAA
TTCAAATACAGTTCCTACTGGGTAGTAGGCAGTTTCGGAC
CAAGTCAATTTGAACACAAACCAGGCAAGGAGGAACAATC
GAACTTGGGTTCAGACCAGGCAGTGTGAAAGCGCTTTTAA
TTGTTTTTTGTTGCTTAAAATGTTAAATCCACTTACATTT
ATCAAGTTAATTTAGGGCGCTTTTACACCAGTGGATCGAT
TCTTTTGTTCCAAAACGGGGATTAAAATTGTTACAATGTT
GCTCTTTGTTCTTGGTGTGGTGCGGTTCGCTTTCACACAT
TGAAGTTTCTAAACGAACCACAAGAGCTAAAACAAGTCAC
GTGCGAGTAAACGTTATAGGCTTTTACATGAAACGCTCAT
TTACCGGTAGGAATGACCTCCCGCCCTACTCATAATTCTC
TCTCCATATAGCTGTATATACGCCTATGACATACCCATGA
TACACTGTGATAAAGCTGAGCTCAGATCGTATCGCTTTCT
CACTACAATCGATCTGCTCCAGAGTTTGTTTCAATCGAGC
CGAGATCATCTTATTCATGGACTGATTGATTTGGTGTGGA
TCCGAGCACGATTGCTGGATTCACATATGTCAAACAAGCC
TCACTTACTGGGCAAATGAGACAAAAAAGCACCCTTAATT
GATATGTGTTGGGACAACATGAATCAAATGTGTTGAACCC
TATATTTATTACAATGTATGTTATGTGATAAAAGCTTGAC
CAATGAGAGAATGATATGCAATCAGGAAGCGATTGTTGGT
AGCCACACCTCCATTTTCAAAGTTGTGCATTTCAGTCTGT
CTATCCGCTTAAGTCTTGACGTGTGGAATACTGTTTCCAG
GTTCAAGCGGCTACTCATTTGAATTGAAAAAATTTTTGCT
TATTACCACTTTTTAGTCATATTACACATTAACGTGAATT
TTATATAAAACACAGACACCAATATTTTAACAATTTATTA
AAAAAATAATCACTATCTGGCCAGAAGATATTAGACATGG
TAAAATTGCGATCGTGATTTTCAAAAGTATTACAGTCCTT
GTAAACATTTATTATTACCATTTGTTAAGTCTCCCCTTGA
TATAGTGCTTGGACCCGGATGCCCCTTTGCATGACGTCAC
ACTTAACAAGCAGATACTGAAATGAAACACCAGATTTTCA
AATAAAAATCTTTAGAAAAATCCCTTTTTAATCTTTAGTT
TTTTTTTTAAATGCTTAATTTTCAACGATGTCAAGAGTAG
TGTGGATGAAACAATGGCATAACTAACGAAACATACGCGT
TTTAAAATGAAAACGCACTAGTGTAAATGGCACCAAAGTT
TGTTCCTTGGATTTGTAACTTTATACATGAAAGTGTGAAT
AATATCTCTCTATTACAACGTTCTCAGTTTTGTGACTATA
CACTCACTGGCTATTTTATTAGGTACAGCTTACCGGGTTG
GACCCCCTTTTGCCTTCAGAACTGCCCTAATCCTTTGTGG
CATAGACTCAACAAGATACTGGAAATATTCTTCAGAGACT
TTGGTCCATATTGACATAATAGTATCACGCTGTTGCTGCA
GATTTGTCAGCTGCACATGCATAATACGAATCTCCCGTTC
CAACACATCCCAAAGGTGCTCTACTGGATTGAGCTCTGGT
GACTGGGGAGCCATTTGAGTACAGTGAACACATTGTCATG
TTTAAAAAACCAGTCTGAGATGATTCAGACTTTATGACAT
GGCACGTTATCTTGCTGGAAGTAGCCATCATGATGGGTAC
ACTGTGGTCATAAAGGGATGGACATGGTCAGCAACAATAC
TCAGGTAGGCTGTGGTGTTGACACGATGCTCAATTGGTAC
TAATGGGCCCAAAGTGTGCCAAGGAAATACCTCGGTTGTA
ACGAGTGGTTATTTGAGTTACTGTTTGCCTTTCTAACCAA
TCTGGCCATTCTCCTCTGACCTCTGGCATCAACAAGGCAT
TAACGCCCACAGAACTGCAGCTCACTGCCATTCTCTGTAA
ACCCTGGAGATGGTTGTGCGTGAAAATCCTAGTAGATCAG
CAGTTTCTAAAATACTCAGACCAGCCTGTCTTGCACCATT
GTTCAAAGTCACTTAAATCACCTTTCATCCCCATTCTGAC
GCTCGGTTTAAACAGCAGCAGATAGTTTTGACCATGTCTG
GATGCCTAAATGCATTGAGTTGTTGCCATGCAATTGACTG
ATTAGAAACTTGCGTTAACAAGCAGTTGGACAGGTATACC
TAATAAAGTGGCCAGTGAGTGTACATGCAGCAACCGCAGG
TTTGTTTCAGCTAATATTAGACAGTTTAACTATCTCACAA
TTGCAACTTTCTTTCCCGATATTGTGACTGTTTCTGTGAC
TTTATAATTCACTATGTGACCTTATATGTTAAAACAAGAC
CTATATCGTGCAGTGTGACTTAACATCTCAGCTTTATATC
ACACAGTGCAACTTTTAAACTTTCATCTCACAGTTACTTT
TAATTTTTTTTACTCTGAGGTAAAAAGCGGGCTTCCATAT
GACAGGCGACACGCACAAAGCTATGATTGTATCAAATGAA
AAGTGAGAAAGAGAAAATAGCTTTTGTATTAAATTAATAT
ATGCTACAAATTTGAGCTGTCCATTTACATCTTAGCCATA
ACTTGACCATAAGAAAAGAATGGGGATACAGAAAATAAAT
GATTAAAAAGCAGCCAAAGCTGACAGATTTCACCTCCATA
TAGATTTAGCAGTAACAATTCTTAGAAATTTGATATATAT
ACCTGCTTCGATCTCATTCGGACTTTAGTATTCAGTTCAA
CTCCCTATTAAGTTTGGGGTATCTGTGCCGCAGATCGCAT
ACCCTTTTAGATACTGTGCGTAGATAGATAGTTGGCTTTA
AAGGGATGCTTTGGTTGGTAGTGATATACAGTAGGTAGTT
AGGATTTCTTAATTTACGTCTTAACACGACAGCTCCAGTT
TCAGACTACTGACTTGTTATTTTTATCAAGTAAGACAATT
CCAGTGTGCAGTCTTTATTTATTTTGTTTTTTTATTGTTT
GTGTCAGCACATAGAGATGTCATGGTTATTTGTATAGTTT
GAAATGTAAGTACAAACAAGGCAAAATTTTGAGGGTAAGG
ATGGCTTTATATGTTATCAGTAACACCGGATATCATCATT
TTATCTTTTAAGCTACAATGGGGCTCAGATATTCATATAT
TAAACACATTTTACACAAATAACACATCTGCAAGTGTATT
TGAGATGGTTTTAACACCAAACAAGTCTGAAATCAGTTTT
ATGACGTGTTTCAAAGATGTGAACGTATGATATTTTGCCT
GTTTTGGTTCCCGAGGGGTTGAAGGCTGCTAGTTACTCTT
TAATTATCTCATTTTATCAATGTATTTTTTTGTATCAAAG
AAACATACTGTATTTTTGTTTGTTTGTTTGTTCATTTTTG
AATGTGGTAAATATTTATGGATCCAAGCTTTTATGTTGAA
ACACAATCTGGGGCATATGGATGACTTAAAGGGACATTAT
TCTAACTGTATGCATGTCAACAGTGCCTGCAGTATCTGCC
GAATATACAAAATGGACACCATTGGAAAAATCAGGCTAAA
TAATAAGAGCGAGGTCTGGAATTTGATAAATAAATTGCAA
TATTAGGTCTCCCTGAACAGCAATCCTTCTCAAAGATGCT
TTTTCGTTTGTTTTGCACACAGAAAGTTGATAGGATGATT
TTTGGGGACTTTTGAAAGGTACTTCACCAAGTCAAATGAA
AGCGATCTGGGTGTGTGTATCTATCTTGTTAATTGAAAGA
TATTGTGTGGTCATGCACATTTTGATACGCTGCATCAGGC
TTACACACACTTGTTTTAATCTAACAGTGTTGAACTGTGA
ATAATAATCGTTTGTCACCATTAAGTATTAGAACATGTTT
AAGATCTGTTCTGTCTGTGAACTTGCAGTTGATTCACTGA
AGGCTGTTATTACTACACAATACCTATAAATCGGGAAGCA
GGGTTTTCGTGTCAGATTCCATTGTACGTAAAATGTGTGT
AATAGATTGTGTAATCACATTTTTTATTCTGTGTTATAAT
TCAAAAATTAAGTACGTTTTAATTGCTGATCTTTAGAATC
AATATGGAATTGTATGTAGTTGCTGACTGAAAGCGAGGAA
ACCTTGCTGTTAAAGACTAAAGGATCAGACACAAAAGCCA
AAAGACTCAAGCCTTGAACAACATATACTGTTATTCTACT
CATTTGTCCATGTTAGATCATATTCCTGATATTTGTAAAT
TATTATAAATTGTAATAATTTATCATTTCTTTCTAAAGTC
TTTCAAGCAACTCAGAATTGCTGTTTTGTCACTTATAAAT
ATACACAATAATTTGTACAATTAACAGATTTGGAGAGCTG
TTCAAACTTAAAAAAACTCAATTGGAAGTGGATTTGCATT
AAAAAAACAATCCAAATAGTTTAGCTTAATAAATGGGAAT
TTAATGGTACTAAATCTGTGTTGTATAACGCAGTTTTAAA
TCAGTGTGAAATGAATACACAATAGTACAGAATGTGTATG
GAAGAGGACTGAAAGCTCTTGGAGAGATACATGTTTGTAT
CTGAAGTGTTTCTGAACAGGATTGTGTGCTTTTTTTTGCA
TTTGTGGAACTTGAATTTTTAACCATGTTGTTTATTTAAT
ATTTTGCTTTATTTTGCTATAATGACAAAATGAGACTGGG
GTGACTTTTAATATACCATTGGTTTT

myh14 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA myh14-203 12826
myh14-204 (1)    Ensembl 446
ncRNA myh14-002 (1)    Ensembl 529
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
myh14-203 Contained in:

Genome Resources: Vega_Trans:OTTDART00000046197 (1),  Ensembl_Trans:ENSDART00000142155 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CO916518 (1) 832 bp
GenBank:CK680439 (1) 776 bp
GenBank:CK708461 (1) 755 bp
GenBank:AL921275 (1) 539 bp
GenBank:CR930820 (1) 539 bp
GenBank:EB841631 (1) 482 bp
GenBank:CK674820 (1) 408 bp
GenBank:DN896031 (1) 270 bp
GenBank:EB781366 (1) 217 bp
CITATIONS (2)