header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-160112-498
Transcript Name: myh14-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062816 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062816|OTTDARG00000032971| myh14|no_translation myh14-002 LG_ AL929505.14 Danio rerio protein_coding KNOWN, 529 bp
GGCATGCAGATCAATACAGAGAGCAGTTGGATAAGTCTAT
GGGGCGCCTCCGTCAACTGAAGAGGCAGCTAGAGGAGGTA
GAAGAAGAGAACTCTCGCTCCAATGCCCAGCGCAGGAAAC
TACAGCGAGAGCTGGAGGAAATGAGCGACAGCATGCAGAG
CATGAACCGCGAGCTCAACACTCTCCGCTCCCAACTCAGC
ATCACAGAACGCCAGAAGTCAGAACAGTAGGTTTTCATGT
GTGCATAGATAAAGTGTCAGTCTGTTTGTTTTCCTTCATG
GGCATTTCCCTGTCTCCTCCTGACTCCACTGTTGTTTCCA
GGTTCCCTGCTAAGATTTTAATTTGTCAGTCTTTTGTAAC
TGATTGAATTTACAATCACATCAAGATGGTGTACAGTAGT
CTACCTTGGGTTCTGGGATACTTCCTGGTTATAGATGGGG
ATAAATCAGATTCTTCATTTCACCAATCATAGAACCTTCA
ATCTTTTTCCCTCTTTCTGTCTTCAGGTTATAAACAGTGA
CCCCAAAAA

myh14 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA myh14-203 (1)    Ensembl 12826
myh14-204 (1)    Ensembl 446
ncRNA myh14-002 529
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
myh14-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000062816 (1),  Ensembl_Trans:ENSDART00000138267 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AL918451 (1) 531 bp
CITATIONS (2)