header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-160112-180
Transcript Name: myh14-204
Previous Name: myh14-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062815 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062815|OTTDARG00000032971| myh14|OTTDARP00000049103 myh14-003 LG_ AL929505.14 Danio rerio protein_coding KNOWN, 446 bp
AGAAGAAACTGAAAGAAGTTTTGATGCAAGTGGAGGATGA
AAGAAGGCATGCAGATCAATACAGAGAGCAGTTGGATAAG
TCTATGGGGCGCCTCCGTCAACTGAAGAGGCAGCTAGAGG
AGGTAGAAGAAGAGAACTCTCGCTCCAATGCCCAGCGCAG
GAAACTACAGCGAGAGCTGGAGGAAATGAGCGACAGCATG
CAGAGCATGAACCGCGAGCTCAACACTCTCCGCTCCCAAC
TCAGGAGAGCTCCGCTCCCTCTGTCCATGCGTGCTGGTCG
CAGAGCTCTAGTTGATGACCTTTCTCAGGAGAACTCTGAT
TCTGAAGATCCAGGTGCTTCTCCCACACCGTCCAGCGGCC
CACCGGGTACCCCCACACCCTCAGACAACGCCCTGGGCCC
CCCTCCCCCGTACAGCCTTACAGATGCTGAATAAGAAGGG
GCGAGA

myh14 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA myh14-203 (1)    Ensembl 12826
myh14-204 446
ncRNA myh14-002 (1)    Ensembl 529
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
myh14-204 Contained in:

Genome Resources: Vega_Trans:OTTDART00000062815 (1),  Ensembl_Trans:ENSDART00000173163 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AL924009 (1) 450 bp
CITATIONS (2)