ZFIN ID: ZDB-TSCRIPT-100915-1019
Transcript Name: stat3-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: artifact
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047414 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047414|OTTDARG00000033676|ZDB-GENE-980526-68 stat3|no_translation stat3-003 LG_ CR847978.18 Danio rerio protein_coding KNOWN, 2717 bp
TTTTCGCACAGACCACCGTAGCTCGCGTGTTTGCAGTGTC
AGAAAAGTTGGAAAAGCTCGTTTTACGATAGCATATCGTC
TCTAAAACGCTTGTTTTTGTAGTCAATAACGTGTTGACTG
CGCTTGTTTCCGTGGAGGACGATTTATCTGAAACCTTGAG
CGACACATTAAGGGGTCAACATGGCCCAGTGGAATCAGTT
GCAGCAGTTGGAGACGCGGTATCTGGAGCAGCTGTATCAC
CTGTACAGCGACAGCTTCCCCATGGAGCTCCGACAGTTCT
TGGCCCCCTGGATCGAGAGCCAGGACTGGGCGTATGCGGC
CAACAAGGAGTCTCACGCCACGCTGGTCTTCCACAACCTG
CTGGGCGAGATCGATCAGCAGTACAGCCGCTTCCTGCAGG
AGAACAACGTCCTGTACCAGCACAACCTGCGGCGCATCAA
GCAGCACCTGCAGAGCAAGTATCTGGAGAAGCCCATGGAG
ATTGCCCGCATCGTGGCCCGCTGCCTGTGGGAAGAGCAGC
GTCTACTGCAGACGGCCACCACTGCACAGCAGGATGGCCA
GGTTGCCCATCCCACTGGCACTGTGGTGACAGAAAAACAG
CAGATACTGGAACACAACCTGCAGGACATCAGGAAGAGAG
TACAGGACATGGAGCAGAAGATGAAAATGTTGGAGAATCT
GCAGGATGATTTTGATTTCAACTACAAAACTCTTAAGAGT
GCTGGAGAGCTGTCCCAGGACCTGAATGGAAACAGCCAGG
CAGCAGCCACCAGACAGAAGATGTCTCAGCTGGAGCAGAT
GCTAAGCGCTCTAGATCAGCTCAGGAGGCAAATAGTCACT
GAGATGGCAGGACTGCTGTCTGCCATGGACTTTGTGCAGA
AGAATCTGACAGATGAAGAGCTGGCCGACTGGAAGAGGAG
ACAGCAGATCGCTTGCATCGGTGGGCCACCAAACATCTGC
CTGGACCGCTTGGAGACATGGATTACTTCTTTGGCTGAGT
CACAGCTGCAGATAAGACAGCAGATCAGAAAACTGGAGGA
GCTTCAGCAGAAGGTCTCGTATAAAGGGGACCCCATTATT
CAGCACCGTCCAGCTCTGGAGGAGAAGATCGTAGATCTTT
TCCGCAACCTTATGAAAAGTGCATTTGTTGTGGAGAGGCA
GCCTTGCATGCCCATGCACCCTGACCGACCCCTTGTCATC
AAAACAGGAGTTCAGTTTACCACCAAAGTCAGGTTACTTG
TGAAATTCCCAGAGTTGAATTACCAGCTCAAAATCAAAGT
GTGTATTGACAAGGAGTCAGGTGACGTGGCAGCCATTCGA
GGTTCACGCAAGTTCAACATCCTTGGCACTAACACTAAGG
TGATGAACATGGAGGAATCCAACAATGGCAGCCTGTCAGC
AGAGTTCAAACATCTGCCTCTCTGATAGTGACCGAAGAGT
TGCATCTGATCACATTCGAGACAGAAGTCTACCACCAAGG
ACTTAAGATCGACCTTGAGACGCACTCTCTCCCGGTGGTG
GTCATCTCTAATATCTGTCAAATGCCAAACGCATGGGCCT
CCATCCTGTGGTACAACATGCTGACCAACCATCCCAAGAA
CGTGAATTTCTTCACCAAACCTCCTGTAGGAACATGGGAT
CAGGTGGCGGAGGTGCTCAGCTGGCAGTTCTCGTCCACAA
CCAAAAGAGGACTTACTATTGAGCAGCTCACCACACTTGC
AGAGAAACTTCTGGGTCCCTGTGTAAACTACTCCGGTTGC
CAGATCACATGGGCTAAGTTCTGCAAAGAAAACATGGCAG
GAAAAGGTTTCTCATTCTGGGTGTGGCTGGACAACATTAT
TGACCTGGTGAAGAAATATATTTTGGCCTTATGGAATGAA
GGGTATATTATGGGTTTCATCAGTGAAAGCAGCAAAGAGG
GAGGAATCACATTCACGTGGGTCGAGAAGGACATCAATGG
TAAGACCCAGATTCAGTCGGTTGAACCGTACACTAAGCAG
CAGCTCAACAGCATGTCTTTTGCTGAGATCATCATGGGCT
ACAAGATCATGGATGCCACCAACATCCTAGTGTCGCCGCT
GGTCTACCTGTACCCCGACATTCCCAAAGAGGAGGCGTTT
GGCAAATACTGCCGCCCTGAGGCCCATCCAGACACTGAGT
TCCCTGACACAGGATGTGTAACTCAACCCTACCTGAAGAC
CAAGTTCATCTGTGTCACCCCGTGTCCTTCTGTCTTCATG
GACTTCCCGGACAGTGAGCTGCTTGGGAACGGCTTCCCTG
GGACTAACTCTGGCAACACAAGCGATTTGTTCCCAATGTC
GCCTCGCACGCTCGACTCTCTCATGCACAACGAAGCTGCT
GAGGCCAATCCAGGACCTCTCGAATCCCTCACTCTGGACA
TGGAGTTGAGCTCTGATCATGCGTCACCCATGAGAGAAGG
GTTTGCAGCCTCCACAGTCTCGGATATGGACACCTGCCGA
AATGCTTAGTTTTCCAAGATTTTAGTTTCATTTTTTTTTT
TTTTTTTTTCCATTGGGAAAAGCAATTTTCATGTATATAG
TGAGCTTAGGTGCTACAACTGCTTTCTCTCTCCGAGCCAA
ATTTTGCATTTCTTTTTTTGATTTTACAGTCAGTCAAAAG
TGCAAACAAGCTAAAGTTTTCATTTCAACCTCGACAATAC
TGAAGTTGACTTTAAAATTAAAAAAAAAAAAATAATA

stat3 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA stat3-003 2717
mRNA stat3-201 (1) 2742
stat3-202 (1) 3055
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
stat3-003 Contained in:
OTHER stat3-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000047414 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC045276 (1) 2715bp
    CITATIONS (1)