header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-505
Transcript Name: stat3-202
Previous Names: stat3-001, ottdart00000047413

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047413 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047413|OTTDARG00000033676|ZDB-GENE-980526-68 stat3|OTTDARP00000037250 stat3-001 LG_ CR847978.18 Danio rerio protein_coding KNOWN, 3055 bp
AAACGTGCAGCCCATTTTCGCACAGACCACCGTAGCTCGC
GTGTTTGCAGTGTCAGAAAAGTTGGAAAAGCTCGTTTTAC
GATAGCATATCGTCTCTAAAACGCTTGTTTTTGTAGTCAA
TAACGTGTTGACTGCGCTTGTTTCCGTGGAGGACGATTTA
TCTGAAACCTTGAGCGACACATTAAGGGGTCAACATGGCC
CAGTGGAATCAGTTGCAGCAGTTGGAGACGCGGTATCTGG
AGCAGCTGTATCACCTGTACAGCGACAGCTTCCCCATGGA
GCTCCGACAGTTCTTGGCCCCCTGGATCGAGAGCCAGGAC
TGGGCGTATGCGGCCAACAAGGAGTCTCACGCCACGCTGG
TCTTCCACAACCTGCTGGGCGAGATCGATCAGCAGTACAG
CCGCTTCCTGCAGGAGAACAACGTCCTGTACCAGCACAAC
CTGCGGCGCATCAAGCAGCACCTGCAGAGCAAGTATCTGG
AGAAGCCCATGGAGATTGCCCGCATCGTGGCCCGCTGCCT
GTGGGAAGAGCAGCGTCTACTGCAGACGGCCACCACTGCA
CAGCAGGATGGCCAGGTTGCCCATCCCACTGGCACTGTGG
TGACAGAAAAACAGCAGATACTGGAACACAACCTGCAGGA
CATCAGGAAGAGAGTACAGGACATGGAGCAGAAGATGAAA
ATGTTGGAGAATCTGCAGGATGATTTTGATTTCAACTACA
AAACTCTTAAGAGTGCTGGAGAGCTGTCCCAGGACCTGAA
TGGAAACAGCCAGGCAGCAGCCACCAGACAGAAGATGTCT
CAGCTGGAGCAGATGCTAAGCGCTCTAGATCAGCTCAGGA
GGCAAATAGTCACTGAGATGGCAGGACTGCTGTCTGCCAT
GGACTTTGTGCAGAAGAATCTGACAGATGAAGAGCTGGCC
GACTGGAAGAGGAGACAGCAGATCGCTTGCATCGGTGGGC
CACCAAACATCTGCCTGGACCGCTTGGAGACATGGATTAC
TTCTTTGGCTGAGTCACAGCTGCAGATAAGACAGCAGATC
AGAAAACTGGAGGAGCTTCAGCAGAAGGTCTCGTATAAAG
GGGACCCCATTATTCAGCACCGTCCAGCTCTGGAGGAGAA
GATCGTAGATCTTTTCCGCAACCTTATGAAAAGTGCATTT
GTTGTGGAGAGGCAGCCTTGCATGCCCATGCACCCTGACC
GACCCCTTGTCATCAAAACAGGAGTTCAGTTTACCACCAA
AGTCAGGTTACTTGTGAAATTCCCAGAGTTGAATTACCAG
CTCAAAATCAAAGTGTGTATTGACAAGGAGTCAGGTGACG
TGGCAGCCATTCGAGGTTCACGCAAGTTCAACATCCTTGG
CACTAACACTAAGGTGATGAACATGGAGGAATCCAACAAT
GGCAGCCTGTCAGCAGAGTTCAAACATCTGACTCTACGAG
AGCAGAGATGTGGCAATGGAGGCCGAACCAATAGTGATGC
CTCTCTGATAGTGACCGAAGAGTTGCATCTGATCACATTC
GAGACAGAAGTCTACCACCAAGGACTTAAGATCGACCTTG
AGACGCACTCTCTCCCGGTGGTGGTCATCTCTAATATCTG
TCAAATGCCAAACGCATGGGCCTCCATCCTGTGGTACAAC
ATGCTGACCAACCATCCCAAGAACGTGAATTTCTTCACCA
AACCTCCTGTAGGAACATGGGATCAGGTGGCGGAGGTGCT
CAGCTGGCAGTTCTCGTCCACAACCAAAAGAGGACTTACT
ATTGAGCAGCTCACCACACTTGCAGAGAAACTTCTGGGTC
CCTGTGTAAACTACTCCGGTTGCCAGATCACATGGGCTAA
GTTCTGCAAAGAAAACATGGCAGGAAAAGGTTTCTCATTC
TGGGTGTGGCTGGACAACATTATTGACCTGGTGAAGAAAT
ATATTTTGGCCTTATGGAATGAAGGGTATATTATGGGTTT
CATCAGTAAAGAAAGAGAGAGAGCAATCCTGAGTCCAAAG
CCTCCTGGGACGTTTCTGCTGCGCTTCAGTGAAAGCAGCA
AAGAGGGAGGAATCACATTCACGTGGGTCGAGAAGGACAT
CAATGGTAAGACCCAGATTCAGTCGGTTGAACCGTACACT
AAGCAGCAGCTCAACAGCATGTCTTTTGCTGAGATCATCA
TGGGCTACAAGATCATGGATGCCACCAACATCCTAGTGTC
GCCGCTGGTCTACCTGTACCCCGACATTCCCAAAGAGGAG
GCGTTTGGCAAATACTGCCGCCCTGAGGCCCATCCAGACA
CTGAGTTCCCTGACACAGGATGTGTAACTCAACCCTACCT
GAAGACCAAGTTCATCTGTGTCACCCCGTGTCCTTCTGTC
TTCATGGACTTCCCGGACAGTGAGCTGCTTGGGAACGGCT
TCCCTGGGACTAACTCTGGCAACACAAGCGATTTGTTCCC
AATGTCGCCTCGCACGCTCGACTCTCTCATGCACAACGAA
GCTGCTGAGGCCAATCCAGGACCTCTCGAATCCCTCACTC
TGGACATGGAGTTGAGCTCTGATCATGCGTCACCCATGAG
AGAAGGGTTTGCAGCCTCCACAGTCTCGGATATGGACACC
TGCCGAAATGCTTAGTTTTCCAAGATTTTAGTTTCATTTT
TTTTTTTTTTTTTTTCCATTGGGAAAAGCAATTTTCATGT
ATATAGTGAGCTTAGGTGCTACAACTGCTTTCTCTCTCCG
AGCCAAATTTTGCATTTCTTTTTTTGATTTTACAGTCAGT
CAAAAGTGCAAACAAGCTAAAGTTTTCATTTCAACCTCGA
CAATACTGAAGTTGACTTTAAAATTAAAAAAAAAAAAATA
ATAATGGTTACACTGTAAAAAATGCTTTTCTTGTTTAAAG
TTTTTGTCTTGTTTCTAGTCCAAATATCTACAAAATCTTA
AAGGGCACCTATTTTACCCCTTTTACAGGATGTAATAATC
TTTTGGTGTCTCTAGAATGTGTCTGTAAAGTTTCAGCTCA
AAATACTCATCAGATTATTTATTATAGTAACCAGAATCTG
CACATTTCGGTGTCT

stat3 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA stat3-003 (1) 2717
mRNA stat3-201 (1) 2742
stat3-202 3055
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
stat3-202 Contained in:

OTHER stat3-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000047413 (1)
  • Ensembl_Trans:ENSDART00000104519 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AJ005693 (1) 3069bp
    GenBank:CT717755 (1) 743bp
    GenBank:BM860216 (1) 661bp
    GenBank:AL927623 (1) 538bp
    GenBank:CK689578 (1) 532bp
    CITATIONS (2)