header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-1535
Transcript Name: stat3-201
Previous Names: stat3-002, ottdart00000047415

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047415 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047415|OTTDARG00000033676|ZDB-GENE-980526-68 stat3|OTTDARP00000037251 stat3-002 LG_ CR847978.18 Danio rerio protein_coding KNOWN, 2742 bp
CGTGTTTGCAGTGTCAGAAAAGTTGGAAAAGCTCGTTTTA
CGATAGCATATCGTCTCTAAAACGCTTGTTTTTGTAGTCA
ATAACGTGTTGACTGCGCTTGTTTCCGTGGAGGACGATTT
ATCTGAAACCTTGAGCGACACATTAAGGGGTCAACATGGC
CCAGTGGAATCAGTTGCAGCAGTTGGAGACGCGGTATCTG
GAGCAGCTGTATCACCTGTACAGCGACAGCTTCCCCATGG
AGCTCCGACAGTTCTTGGCCCCCTGGATCGAGAGCCAGGA
CTGGGCGTATGCGGCCAACAAGGAGTCTCACGCCACGCTG
GTCTTCCACAACCTGCTGGGCGAGATCGATCAGCAGTACA
GCCGCTTCCTGCAGGAGAACAACGTCCTGTACCAGCACAA
CCTGCGGCGCATCAAGCAGCACCTGCAGAGCAAGTATCTG
GAGAAGCCCATGGAGATTGCCCGCATCGTGGCCCGCTGCC
TGTGGGAAGAGCAGCGTCTACTGCAGACGGCCACCACTGC
ACAGCAGGATGGCCAGGTTGCCCATCCCACTGGCACTGTG
GTGACAGAAAAACAGCAGATACTGGAACACAACCTGCAGG
ACATCAGGAAGAGAGTACAGGACATGGAGCAGAAGATGAA
AATGTTGGAGAATCTGCAGGATGATTTTGATTTCAACTAC
AAAACTCTTAAGAGTGCTGGAGAGCTGTCCCAGGACCTGA
ATGGAAACAGCCAGGCAGCAGCCACCAGACAGAAGATGTC
TCAGCTGGAGCAGATGCTAAGCGCTCTAGATCAGCTCAGG
AGGCAAATAGTCACTGAGATGGCAGGACTGCTGTCTGCCA
TGGACTTTGTGCAGAAGAATCTGACAGATGAAGAGCTGGC
CGACTGGAAGAGGAGACAGCAGATCGCTTGCATCGGTGGG
CCACCAAACATCTGCCTGGACCGCTTGGAGACATGGATTA
CTTCTTTGGCTGAGTCACAGCTGCAGATAAGACAGCAGAT
CAGAAAACTGGAGGAGCTTCAGCAGAAGGTCTCGTATAAA
GGGGACCCCATTATTCAGCACCGTCCAGCTCTGGAGGAGA
AGATCGTAGATCTTTTCCGCAACCTTATGAAAAGTGCATT
TGTTGTGGAGAGGCAGCCTTGCATGCCCATGCACCCTGAC
CGACCCCTTGTCATCAAAACAGGAGTTCAGTTTACCACCA
AAGTCAGGTTACTTGTGAAATTCCCAGAGTTGAATTACCA
GCTCAAAATCAAAGTGTGTATTGACAAGGAGTCAGGTGAC
GTGGCAGCCATTCGAGGTTCACGCAAGTTCAACATCCTTG
GCACTAACACTAAGGTGATGAACATGGAGGAATCCAACAA
TGGCAGCCTGTCAGCAGAGTTCAAACATCTGACTCTACGA
GAGCAGAGATGTGGCAATGGAGGCCGAACCAATAGTGATG
CCTCTCTGATAGTGACCGAAGAGTTGCATCTGATCACATT
CGAGACAGAAGTCTACCACCAAGGACTTAAGATCGACCTT
GAGACGCACTCTCTCCCGGTGGTGGTCATCTCTAATATCT
GTCAAATGCCAAACGCATGGGCCTCCATCCTGTGGTACAA
CATGCTGACCAACCATCCCAAGAACGTGAATTTCTTCACC
AAACCTCCTGTAGGAACATGGGATCAGGTGGCGGAGGTGC
TCAGCTGGCAGTTCTCGTCCACAACCAAAAGAGGACTTAC
TATTGAGCAGCTCACCACACTTGCAGAGAAACTTCTGGGT
CCCTGTGTAAACTACTCCGGTTGCCAGATCACATGGGCTA
AGTTCTGCAAAGAAAACATGGCAGGAAAAGGTTTCTCATT
CTGGGTGTGGCTGGACAACATTATTGACCTGGTGAAGAAA
TATATTTTGGCCTTATGGAATGAAGGGTATATTATGGGTT
TCATCAGTAAAGAAAGAGAGAGAGCAATCCTGAGTCCAAA
GCCTCCTGGGACGTTTCTGCTGCGCTTCAGTGAAAGCAGC
AAAGAGGGAGGAATCACATTCACGTGGGTCGAGAAGGACA
TCAATGGTAAGACCCAGATTCAGTCGGTTGAACCGTACAC
TAAGCAGCAGCTCAACAGCATGTCTTTTGCTGAGATCATC
ATGGGCTACAAGATCATGGATGCCACCAACATCCTAGTGT
CGCCGCTGGTCTACCTGTACCCCGACATTCCCAAAGAGGA
GGCGTTTGGCAAATACTGCCGCCCTGAGGCCCATCCAGAC
ACTGAGTTCCCTGACACAGGATGTGTAACTCAACCCTACC
TGAAGACCAAGTTCATCTGTGTCACCCCGACTAACTCTGG
CAACACAAGCGATTTGTTCCCAATGTCGCCTCGCACGCTC
GACTCTCTCATGCACAACGAAGCTGCTGAGGCCAATCCAG
GACCTCTCGAATCCCTCACTCTGGACATGGAGTTGAGCTC
TGATCATGCGTCACCCATGAGAGAAGGGTTTGCAGCCTCC
ACAGTCTCGGATATGGACACCTGCCGAAATGCTTAGTTTT
CCAAGATTTTAGTTTCATTTTTTTTTTTTTTTTTTTCCAT
TGGGAAAAGCAATTTTCATGTATATAGTGAGCTTAGGTGC
TACAACTGCTTTCTCTCTCCGAGCCAAATTTTGCATTTCT
TTTTTTGATTTTACAGTCAGTCAAAAGTGCAAACAAGCTA
AAGTTTTCATTTCAACCTCGACAATACTGAAGTTGACTTT
AAAATTAAAAAAAAAAAAATAA

stat3 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA stat3-003 (1) 2717
mRNA stat3-201 2742
stat3-202 (1) 3055
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
stat3-201 Contained in:

OTHER stat3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000047415 (1)
  • Ensembl_Trans:ENSDART00000080854 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC068320 (1) 2738bp
    GenBank:CK236555 (1) 674bp
    CITATIONS (2)