header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091203-278
Transcript Name: piwil1-204
Previous Name: piwil1-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045630 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045630|OTTDARG00000020442|ZDB-GENE-030813-2 piwil1|OTTDARP00000036019 piwil1-003 LG_ CR450819.7 Danio rerio protein_coding KNOWN, 762 bp
GAAGAAAGAAACTCAGAGGTTTAGAACTACGTGAGGGGCT
GAAATACATCAGCATTTGTAAAGCACCGGTATGACAGGAC
GAGCAAGAGCAAGATCGAGGGGCAGAGGTCGTGGTCAGGA
GCCTGCTGCTCCTGGCGCACAATATGGTCTTGACATAACA
GATGGCAACCAGGTTCTTCTCGTTAGCCATGTGAAGAGAC
TTGGCCCCTCAGGACGCCCTCCACCGGGACCAGCTATGCT
TGTCCCCGAGTTCTGCTACCTCACTGGTCTAACCGATAAA
ATGCGTGCTGATTTTAACATCATGAAGGATCTTGCTTCAC
ATACACGGCTAAGTCCTGAACAGAGAGAGGGCAGAATTAA
CCGCTTAATCTCCAACATCAACAGAAATGGAGACGTGCAG
AATGAACTGACTACTTGGGGTCTGAGCTTTGAGAACAAGC
TTCTTAGTCTTAATGGGAGAGTTTTGCCCTCTGAGAGGAT
CATACAGGGAGGCAGAGCATTTGAGTATAACCCATGGACA
GCAGACTGGTCTAAAGAGATGAGAGGTCTCCCTCTGATTA
GCTGCATGTCTCTGGACAACTGGCTCATGTTCTACACGCG
CAGAAATGCAGATGTTGCCCAATCTCTGCTTCAGACTCTC
AACAAAGTGTCTGGACCCATGGGGATCCGCATGCAGAGGG
CTGTCATGATTGAGTATGAAGATCGTCAGGAATCTCTCCT
TAGAGCTTTGCAACAAAACGTAGCACGTGAAACTCAGATG
GT

piwil1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA piwil1-203 (1)    Ensembl 549
piwil1-204 762
piwil1-205 (1)    Ensembl 3257
piwil1-206 (1)    Ensembl 915
ncRNA piwil1-006 (1)    Ensembl 898
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
piwil1-204 Contained in:

Genome Resources: Vega_Trans:OTTDART00000045630 (1),  Ensembl_Trans:ENSDART00000133021 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DV591232 (1) 798 bp
CITATIONS (2)