ZFIN ID: ZDB-TSCRIPT-091203-165
Transcript Name: piwil1-203
Previous Name: piwil1-005

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045632 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045632|OTTDARG00000020442|ZDB-GENE-030813-2 piwil1|OTTDARP00000047967 piwil1-005 LG_ CR450819.7 Danio rerio protein_coding KNOWN, 549 bp
AGAAACTCAGAGGTTTAGAACTACGTGAGGGGCTGAAATA
CATCAGCATTTGTAAAGCACCGGTATGACAGGACGAGCAA
GAGCAAGATCGAGGGGCAGAGAAACCTGCACCTGGAGCCA
TGTCTGAAGAAGCGATGCTCCAGATTTCTGCTGGCTTTCA
GCAGGTGAAGATCGGGGAGAGAGGTGGACGCAGACGGGAT
TTCCACGATTCTGGTGTCCATACTCGTCAACTTATGGAAC
ACGTGAAAGAATCCAAAACAGGTGTTTCTGGGACTGCCAT
TGAGCTGAGGGCCAATTTTATGCGTCTGCTTTCACGTCCT
ATGTGGGCTTTGTATCAGTATCATGTGGACTACAAGCCAC
CAATGGAGTCCAGACGACTGCGTTCGGCTTTGCTTTTCCA
GCACGAGGAGACTCTGGGGAAAGCACACACCTTTGATGGA
GCCATTCTCTTTCTCCCCAACAAACTGCGCAACGCTGAGA
CAGTCCTGTGCAGTGAGACCAGAAATGGAGAGAAGGTTGA
GATCACTGTGACACTGACCAATGAGCTGC

piwil1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA piwil1-203 549
piwil1-204 (1)    Ensembl 762
piwil1-205 (1)    Ensembl 3257
piwil1-206 (1)    Ensembl 915
ncRNA piwil1-006 (1)    Ensembl 898
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
piwil1-203 Contained in:

Genome Resources: Vega_Trans:OTTDART00000045632 (1),  Ensembl_Trans:ENSDART00000132473 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EB915336 (1) 549 bp
CITATIONS (2)