ZFIN ID: ZDB-TSCRIPT-090929-8292
Transcript Name: piwil1-205
Previous Name: piwil1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025562 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025562|OTTDARG00000020442|ZDB-GENE-030813-2 piwil1|OTTDARP00000021018 piwil1-001 LG_ CR450819.7 Danio rerio protein_coding KNOWN, 3257 bp
GAAGAAAGAAACTCAGAGGTTTAGAACTACGTGAGGGGCT
GAAATACATCAGCATTTGTAAAGCACCGGTATGACAGGAC
GAGCAAGAGCAAGATCGAGGGGCAGAGGTCGTGGTCAGGA
GCCTGCTGCTCCTGGCGCACAACCACCTGTATCTCAAGAG
GCTGCAAAGCCTGTTGTGTCCACTCCGTCTGAAGGACAAC
TGGTGGGCAGAGGGAGACAGAAACCTGCACCTGGAGCCAT
GTCTGAAGAAGCGATGCTCCAGATTTCTGCTGGCTTTCAG
CAGGTGAAGATCGGGGAGAGAGGTGGACGCAGACGGGATT
TCCACGATTCTGGTGTCCATACTCGTCAACTTATGGAACA
CGTGAAAGAATCCAAAACAGGTGTTTCTGGGACTGCCATT
GAGCTGAGGGCCAATTTTATGCGTCTGCTTTCACGTCCTA
TGTGGGCTTTGTATCAGTATCATGTGGACTACAAGCCACC
AATGGAGTCCAGACGACTGCGTTCGGCTTTGCTTTTCCAG
CACGAGGAGACTCTGGGGAAAGCACACACCTTTGATGGAG
CCATTCTCTTTCTCCCCAACAAACTGCGCAACGCTGAGAC
AGTCCTGTGCAGTGAGACCAGAAATGGAGAGAAGGTTGAG
ATCACTGTGACACTGACCAATGAGCTGCCGCCGTCCTCTC
CTGTATGCCTGCAGTTTTACAACATCCTCTTCAGGAGAAT
CCTAAGAATACTAAACATGCAGCAGATCGGACGTCATTAC
TACAATCCTGATGACCCATTCAACATCCCACAGCACAGGC
TGACAATTTGGCCTGGCTTCATGACCACCATCCTACAGTA
CGAGTCCAGCATCATGCTGTGCTCTGATGTGAGCCACAAG
GTTCTGCGCAGTGAGACGGTTCTTGACTTTATGTACAGTC
TGAGACAGCAGTGTGGAGACCAGCGCTTCCCTGAAGCCTG
CACGAAGGAGCTTGTGGGCCTGATCATTCTGACCAAGTAC
AACAACAAGACATACAGGATTGATGACATTGCCTGGGATC
ATACTCCCAACAACACATTCAAGAAAGGAGATACAGAAAT
TTCATTCAAGAACTACTTCAAATCGCAATATGGTCTTGAC
ATAACAGATGGCAACCAGGTTCTTCTCGTTAGCCATGTGA
AGAGACTTGGCCCCTCAGGACGCCCTCCACCGGGACCAGC
TATGCTTGTCCCCGAGTTCTGCTACCTCACTGGTCTAACC
GATAAAATGCGTGCTGATTTTAACATCATGAAGGATCTTG
CTTCACATACACGGCTAAGTCCTGAACAGAGAGAGGGCAG
AATTAACCGCTTAATCTCCAACATCAACAGAAATGGAGAC
GTGCAGAATGAACTGACTACTTGGGGTCTGAGCTTTGAGA
ACAAGCTTCTTAGTCTTAATGGGAGAGTTTTGCCCTCTGA
GAGGATCATACAGGGAGGCAGAGCATTTGAGTATAACCCA
TGGACAGCAGACTGGTCTAAAGAGATGAGAGGTCTCCCTC
TGATTAGCTGCATGTCTCTGGACAACTGGCTCATGTTCTA
CACGCGCAGAAATGCAGATGTTGCCCAATCTCTGCTTCAG
ACTCTCAACAAAGTGTCTGGACCCATGGGGATCCGCATGC
AGAGGGCTGTCATGATTGAGTATGAAGATCGTCAGGAATC
TCTCCTTAGAGCTTTGCAACAAAACGTAGCACGTGAAACT
CAGATGGTGGTGGTGATCTTGCCTACCAATCGAAAAGACA
AGTACGACTGTGTAAAGAAGTACCTGTGTGTGGACTGCCC
TACTCCTAGTCAGTGTGTGGTGTCTCGCACCATCAGCAAA
CCTCAAGCACTTATGACTGTGGCCACCAAGATTGCTTTGC
AGATGAACTGCAAAATGGGAGGAGAGCTGTGGAGTGTAGA
AATTCCACTCCGGCAGCTCATGATTGTAGGTATAGACTGC
TACCATGATACCGCTGCTGGAAAAAGGTCCATCGGCGCAA
TGGTGGCCAGTCTAAATCAGGGCATGTCAAGGTGGTTCTC
CAAGTGTGTCTTGCAAAACCGTGGACAGGAGATCATCGAT
GCACTGAAGGGGTCATTGCAGGGTGCTCTGAAGGCCTATC
TGAAATACAACAATTCTCTGCCCTCGCGCATCATTGTTTA
CCGAGATGGAGTTGGAGATGGCATGCTGCAGAGCGTTGTG
GACTATGAAGTTCCTCAGATCATGCAGTCTATCAAGACCA
TGGGGCAAGATTATGAGCCCAAGCTCTCAGTAGTGGTGGT
GAAAAAGCGCATCAGCTCCCGATTCTTTGCTCGGATTGAT
GGCAAAATTGCCAATCCCCCTCCTGGGACAGTCATTGACA
CTGAAGTCACTCGTCCAGAGTGGTATGATTTCTTCATTGT
AAGCCAGGCTGTGCGCTTTGGGTGTGTCGCACCTACTCAC
TACAATGTGGTGTTTGACAACAGCGGCCTTAAACCAGATC
ACATGCAGAGACTCACCTACAAACTTTGCCACATGTACTA
CAACTGGCAGGGGATTGTGCGAGTGCCAGCTCCATGCCAG
TATGCCCACAAATTGGCCTTCCTGGTTGGCCAGAGCATTC
ACAAGGAGCCTAACATGAATCTGGATGACTTCCTGTATTA
CCTGTAACTGGTTAAAGAGTCAAGATGCAGGGTCCTGAAG
GAACAGTGTGACCGTAGTTTCTTTTTCGAGTTGAATGGAA
AAGAGTATGCTATTCGGAGAACTTTCATTTCATAGCTACA
AAGTTTTGAGAAGAGCAGGTATAACAAAAAAGTTTTGTTT
GAAAGGGGAAATGCTTTTATTTCAGATATTGATTTCAATT
GTGTGCCTTGAGTTCAATCTGGTGCCTTGTGATTATAAGA
CTCCTTTTTTTTGTAATAAGATGTTCAAATCTCAAATTTC
TGTATTTAGAGATTGTTAATTGAATTAAAAAGTAAACATT
TATTTTCTGGGTTCCAATTTGAAAGATAAATCGTTGTAAT
GTAAGTGCTCCTACTTACTACTAACAATGATGTAAAGTTT
GCATGTTTCACGTACTATTAAATGCTGTGATTGTAGCCCT
CCTACTTTTGTGATTTGAATTCTAGTACAACATAGCAACA
TAGTTATGGTAAAAGTTTTACAAAGTAAATAAATGTGTAA
ATAAAATACTTGACGAGCTAACCTCAATTTGTTGAAAACA
TGTTTCAATTTCATTTGAGAATAAAGCTGAAGTTCACACT
GTTTGGATCATTTGACA

piwil1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA piwil1-203 (1)    Ensembl 549
piwil1-204 (1)    Ensembl 762
piwil1-205 3257
piwil1-206 (1)    Ensembl 915
ncRNA piwil1-006 (1)    Ensembl 898
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
piwil1-205 Contained in:

Genome Resources: Vega_Trans:OTTDART00000025562 (1),  Ensembl_Trans:ENSDART00000138019 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AF336369 (1) 3273 bp
GenBank:CN317651 (1) 897 bp
GenBank:BQ284612 (1) 655 bp
GenBank:BQ450162 (1) 643 bp
GenBank:BM036410 (1) 583 bp
GenBank:BM316131 (1) 532 bp
CITATIONS (2)