header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-995
Transcript Name: mcf2la-203
Previous Names: mcf2l-002, mcf2la-002, otpa-001, ottdart00000043511, si:dkey-269p14.1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043511 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043511|OTTDARG00000030069|ZDB-GENE-090312-122 mcf2la|OTTDARP00000034496 DKEY-269P14.1-002 LG_none BX470136.8,CR759780.11,BX294379.5 Danio rerio protein_coding NOVEL, 637 bp
TGAGAAAGCCCCGTCATACAGCTTCAAACACTCGCTCAGT
ATGAGTGCTGTGGGTATTACAGAGAACGCCAAAGGAGACA
ACAAAAAGTTTGAGATCTGGTGTAATTCTCGAGAGGAAGT
GTATATTGTGCAGGCATCAACACCAGAGATCAAAACAGCA
TGGGTGAATGAGATCCGGAAGGTTCTGACAAGGCAGCTAA
AGGCCTGCAGGGAGGCGAGCCAGCAGAAGAGCTCCGATCA
GATCTCCCCATTAACTCCCAGCAGCACCGGCCTGACCCTG
AGCCCCTTCAAAACAAACCCAAAGAGCCTGAAGAAAGGAG
ACGAGAAGAAAACAGAACCCACGACCACAGATCCCAGCTC
AGCCGCCTTATTCAAAAACAACGACAAGCTCAAAGGCTTC
ACCAAGGCGTCGCTGTCTATGGATGCGTCTGAAGAAAACG
ACGGATACTCGAGCGCCGAGGACCCCATGAACTCTGACCC
TGAGGATGAGGGAGGGAAGAAATTGTCTCCAGGCAAGTAC
GTAGTGGTTGCTGACCATGACAAAAGTGGACCACAGGAGC
TGACTGTTAAGAGCGGAGACACTGTGCAACTGGTCCGAGA
GGGAGACGATGGACGCTGGTTTGTTCGTAACCTGCGG

mcf2la TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA mcf2la-003 (1) 195
mRNA mcf2la-201 (1) 4010
mcf2la-203 637
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mcf2la-203 Contained in:

OTHER mcf2la-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000043511 (1)
  • Ensembl_Trans:ENSDART00000144821 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AL716830 (1) 799 bp
    GenBank:CD584507 (1) 379 bp
    CITATIONS (2)