header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-21508
Transcript Name: mcf2la-003
Previous Names: mcf2l-003, ottdart00000041457, si:dkey-269p14.1-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000041457 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000041457|OTTDARG00000030069|ZDB-GENE-090312-122 mcf2la|no_translation DKEY-269P14.1-003 LG_none BX470136.8,CR759780.11,BX294379.5 Danio rerio protein_coding NOVEL, 195 bp
CCCTGAGCCCCTTCAAAACAAACCCAAAGAGCCTGAAGAA
AGGAGACGAGAAGAAAACAGAACCCACGACCACAGATCCC
AGCTCAGCCGCCTTATTCAAAAACAACGACAAGCTCAAAG
ACGCAGGTCCTCACATCACTCTCACCCGAGTGAGATGGCT
GAGCACTTCTAGTCTGTTGCAGACTAAACGCAGAG

mcf2la TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA mcf2la-003 195
mRNA mcf2la-201 (1) 4010
mcf2la-203 (1) 637
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mcf2la-003 Contained in:

OTHER mcf2la-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000041457 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AL923900 (1) 204 bp
    CITATIONS (1)