header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-21506
Transcript Name: mcf2la-201
Previous Names: mcf2l-001, mcf2la-001, si:dkey-269p14.1-001, si:dkey-269p14.1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000041455 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000041455|OTTDARG00000030069|ZDB-GENE-090312-122 mcf2la|OTTDARP00000033112 DKEY-269P14.1-001 LG_none BX470136.8,CR759780.11,BX294379.5 Danio rerio protein_coding NOVEL, 4010 bp
GGGAGATGCGGATATGTGAAGTGCGCTGACGGACGCTTTA
GCTTCAGTAATGTCCTGCAGAAGGATGAAGCCCCAGAGAT
AGAGGCACCTGGGGACCGGCGGAGGTGCTCTCTGAGCGGG
ATGGAGCTCAACCGAGTGTCCCTGCTCTGTCAGGACATTA
CCAAACTCTGGCTGCAGCTCAAAGTCTTGACAGATGAGAT
TATGCAGCAGGAGAGCAGTCCTCTGTGTGCCGCAGACATC
AGCCCAGACCTCAGGAAACAGTTTGCCTTCTTGTCTGGTG
GCCGAGGACAGAACGGCAGCCCCATCATTATTTTCCCAGA
GTACCCGGAGTTTGGTGAGCTGGAGGAGCAGGAGTTTCAC
AATGTGCTGACATACCTGACCAGCATTCCCAGTCTCAGCT
CGACGGGGATCGGCTTCATCCTGGTCATTGACCGCCGGCA
AGACAGATGGGCATCAGTGAAGGGGACACTGCTGCGGATC
GCGGGCTCTTTCCCAGGCAACCTGCAGCTGGTGCTGGTAC
TGAGACCCACAACACTCTTCCAGCGCACAATCTCAGACAT
ATTATTTAAATTCAACAAAGATGACTTTAAAATGAAGGTG
CCGGTGATCATGCTCAGCTCTGTGACTGAGCTCCACAGTT
ACATCGACCGCTCTCAGCTCACTCAGGAACTGGGCGGCAC
GCAGGAATACTGCCACGAGAAGTGGATTTCACACCGCACC
GCCATTGAGGGTTTTGCTCTGATGGTGAAGAAAACAGCAC
AGACTTTGCAGTCTTTCGGGACGGAGCTGGCGGAGACTGA
ACTGCCTAATGATGTTGAGGCCACGTCCAACCTTCTTACC
GTCCACACCGAGAAGAAGGACAAAATGAAGGAGGACCTCA
GGATCGCTCTCTGTCAGGGAGGACGTTTGCTGGAGAGCAT
CAATGAGCCGCTGGTGAAAGATCCAGATTATAGCATGAAC
CACGATGAACTGGAGAACCTGGCTACTGTTCAGAGGTTGC
TCGGTCAGCTAGATGAGACTGAAACGGCATTTGATGATTT
CTGGGATAAACATCAGACCAAGCTGGAGCAATGTCTGCAA
CTGCGGCACTTTGAGCAGAACTTCCGGGAGGTTAGAGCTC
ACCTAGACCTGGTTTACGACCGACTATCAGGATTCTCCGA
AGTAGGAATCAGCCCGGCCCATGCTGAACACATCCTCAAA
GAACTGACCAATCACGAAGAGAGAGCATCCGAGGTGATGG
ACCAGGCTCTGTCTCTTGCGAGTGATGCAGATCAGCTGAT
TGAAGCGTCTCATTATGCTGTGGACTCCATCCTGCCCAAA
TGCTCTGAGCTGCGCTCTGTGTGTGAGGAGATCAGCACCA
TCCTGAGGGCCAAGAAAGCCTATTTGTTCAAATCCGTGGA
GCTTCACCAGTGTCTGGAGAAGGCCACTAAATGGTATGAT
GATGGAATCTACCTGCTGGCGTCTCAGCCTGTGGATAAGT
GTCAGTCACAGGATGGGGCGGAGTCAGCGCTGCAAGAGAT
TGAACGTTACTTGGATACAGCCAATCAGCACAAGCTAACA
GATTTGAATGGAATTTGGAGGGACTATGATTCCGTACTCA
CACAAGACTTCAGGGATCAGGTTGACAAAGTGTTTCAGAA
GCAGCTGTCCATGCAGGAAATGTTTGAGAAGAGAAGGGTC
AGTCTGAAGAAGCTAGCAGCTAAACAAACTCGACCCGTGC
AGCCTGTCGCTCCACGTCCTGAAGCCATCATCAAAACACC
AGTCTCATCTCCAGCTCATAGAGAGAAGTCTATAGAAGGC
GACGTCATCAATGGAAACTGCAAAAAAGGAGAGCTGCATT
TACAGAACGAGGGCAGCAGCAGACACCCGTCCGTCTCTGA
TGAAGAGGAGAACTTCGCTGTGCTCAGACGGCACGTGATG
AACGAGCTGCTGGAGACAGAGAGAGCGTATGTGGAGGAGC
TGCTGTGCGTGTTGGAGGGTTATGCAGCAGAAATGGACAA
TCCTGCCATGTCTCACCTCATCCCCAACACACTGCTTCAC
AAGAAGGACATCCTCTTCGGAAACATGTCTGAGATCTACC
AGTTCCACAAGAAGACTTTTCTTCGTGAACTGGAGGCTTA
CACAGATTATCCTGAGCTTGTGGGACAGTGTTTCTTGGAA
AGAATGACAGATCTGCAGATTTATGAGAAGTACTGTCAGA
ACAAACCTCGCTCAGAGTCTTTATGGAGACAGTGCTCTGA
CTGCGCTTTCTTCCAGGAGTGTCAAAAGAAACTGGAACAT
AAGCTTGGTCTGGACTCATACCTGCTGAAACCTGTGCAGA
GAATAACCAAATACCAGCTTTTACTAAAGGAGCTGCTGAA
GTACAGTAAAGGCTGTGAGGGTGAGGAGGACCTACAGGAG
GCGCTCTCATCCATTCTTGGCATCCTAAAAGCTGTGAACG
ACTCTATGCACCTCATCGCCATCACTGGATACGAAGGTAA
CCTCAGTGATCTGGGCCGTCTGATGATGCAGGGCTCCTTC
AGCGTGTGGACGGAGCATAAGAAGGGTCACGCCAAGGTAA
AAGACCTGGCACGATTCAAGCCCATGCAGAGACACCTGTT
CCTGCACGAGAAAGCTCTGCTCTTCTGTAAGAAACGAGAG
GAGAACGGGGAGGGTTATGAGAAAGCCCCGTCATACAGCT
TCAAACACTCGCTCAGTATGAGTGCTGTGGGTATTACAGA
GAACGCCAAAGGAGACAACAAAAAGTTTGAGATCTGGTGT
AATTCTCGAGAGGAAGTGTATATTGTGCAGGCATCAACAC
CAGAGATCAAAACAGCATGGGTGAATGAGATCCGGAAGGT
TCTGACAAGGCAGCTAAAGGCCTGCAGGGAGGCGAGCCAG
CAGAAGAGCTCCGATCAGATCTCCCCATTAACTCCCAGCA
GCACCGGCCTGACCCTGAGCCCCTTCAAAACAAACCCAAA
GAGCCTGAAGAAAGGAGACGAGAAGAAAACAGAACCCACG
ACCACAGATCCCAGCTCAGCCGCCTTATTCAAAAACAACG
ACAAGCTCAAAGACGAGACTGTCGTCAGTCCCAACACTGA
GAGAGCTGCAGTGGCTAAAAAGCGCTTTACACTGCAGGGC
TTCAGTAACCTCAAGAGTCAAAAAGGATCATCCCCCCCTA
GTCCCGACCACAAAACTAAAAGACAGAGTGATCCTACACC
GTTTGGCTTCAGAGGCTTCACCAAGGCGTCGCTGTCTATG
GATGCGTCTGAAGAAAACGACGGATACTCGAGCGCCGAGG
ACCCCATGAACTCTGACCCTGAGGATGAGGGAGGGAAGAA
ATTGTCTCCAGGCAAGTACGTAGTGGTTGCTGACCATGAC
AAAAGTGGACCACAGGAGCTGACTGTTAAGAGCGGAGACA
CTGTGCAACTGGTCCGAGAGGGAGACGATGGACGCTGGTT
TGTTCGTAACCTGCGGACCAGCAAAGAGGGCTGGGTTCCT
GCTGCAAACCTGCTCACGCTCATCGGAGAGTCCAAATCTT
CTCAGTCTCTCTCCAGCTCAGAAGGCAGTGGGTCTGGAAA
CCTCAGTACATCGTCCAGCTGCAGTGAAACCTACACAAGC
TTCTCGGACATTAAAGCCTGATGTTAAAGCCCCTGCGCCT
GGCTCCTGGCAGCTCTACACACTGCACTTTCTACTCAAGC
TCTAGTCTCCGTACTGTATTTAATCTCTTCGCCAGAGAAA
GATTGGCCGTCTATACGCGCCATTCAGGATATTTTATACC
GAGCGCCTCTCGTTCACAAGCTTCTCTCCTTCATAAGAGA
GAGAAGAAGGAAACTGTGATTCAGTGTTTGCTGTTCCCAT
TCGATCTCTCCTTTCCTTTGAAAGTATCATTGTGATGCTG
TTTGTTTGGCGTCTGCATGCATTTCCTCAAAGATTCAAAG
GGTTTTTGGTGGAGTCGGCGTTAAGATCAGAGTAGCCTGC
GGTTTTAACTGTACATTACGAGGACTTTAAATGTACGATC
ACATGAGCTT

mcf2la TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA mcf2la-003 (1) 195
mRNA mcf2la-201 4010
mcf2la-203 (1) 637
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mcf2la-201 Contained in:

OTHER mcf2la-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000041455 (1)
  • Ensembl_Trans:ENSDART00000114083 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK699127 (1) 820 bp
    GenBank:EB949552 (1) 690 bp
    GenBank:AL716741 (1) 678 bp
    GenBank:AL921259 (1) 539 bp
    GenBank:EB975742 (1) 505 bp
    GenBank:AL716701 (1) 483 bp
    GenBank:EB776192 (1) 360 bp
    CITATIONS (2)