Transcript

mcf2la-201

ID
ZDB-TSCRIPT-090929-21506
Name
mcf2la-201
Previous Names
  • mcf2l-001
  • mcf2la-001
  • si:dkey-269p14.1-001
  • si:dkey-269p14.1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041455 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041455|OTTDARG00000030069|ZDB-GENE-090312-122 mcf2la|OTTDARP00000033112 DKEY-269P14.1-001 LG_none BX470136.8,CR759780.11,BX294379.5 Danio rerio protein_coding NOVEL, 4010 bp
GGGAGATGCGGATATGTGAAGTGCGCTGACGGACGCTTTA
GCTTCAGTAATGTCCTGCAGAAGGATGAAGCCCCAGAGAT
AGAGGCACCTGGGGACCGGCGGAGGTGCTCTCTGAGCGGG
ATGGAGCTCAACCGAGTGTCCCTGCTCTGTCAGGACATTA
CCAAACTCTGGCTGCAGCTCAAAGTCTTGACAGATGAGAT
TATGCAGCAGGAGAGCAGTCCTCTGTGTGCCGCAGACATC
AGCCCAGACCTCAGGAAACAGTTTGCCTTCTTGTCTGGTG
GCCGAGGACAGAACGGCAGCCCCATCATTATTTTCCCAGA
GTACCCGGAGTTTGGTGAGCTGGAGGAGCAGGAGTTTCAC
AATGTGCTGACATACCTGACCAGCATTCCCAGTCTCAGCT
CGACGGGGATCGGCTTCATCCTGGTCATTGACCGCCGGCA
AGACAGATGGGCATCAGTGAAGGGGACACTGCTGCGGATC
GCGGGCTCTTTCCCAGGCAACCTGCAGCTGGTGCTGGTAC
TGAGACCCACAACACTCTTCCAGCGCACAATCTCAGACAT
ATTATTTAAATTCAACAAAGATGACTTTAAAATGAAGGTG
CCGGTGATCATGCTCAGCTCTGTGACTGAGCTCCACAGTT
ACATCGACCGCTCTCAGCTCACTCAGGAACTGGGCGGCAC
GCAGGAATACTGCCACGAGAAGTGGATTTCACACCGCACC
GCCATTGAGGGTTTTGCTCTGATGGTGAAGAAAACAGCAC
AGACTTTGCAGTCTTTCGGGACGGAGCTGGCGGAGACTGA
ACTGCCTAATGATGTTGAGGCCACGTCCAACCTTCTTACC
GTCCACACCGAGAAGAAGGACAAAATGAAGGAGGACCTCA
GGATCGCTCTCTGTCAGGGAGGACGTTTGCTGGAGAGCAT
CAATGAGCCGCTGGTGAAAGATCCAGATTATAGCATGAAC
CACGATGAACTGGAGAACCTGGCTACTGTTCAGAGGTTGC
TCGGTCAGCTAGATGAGACTGAAACGGCATTTGATGATTT
CTGGGATAAACATCAGACCAAGCTGGAGCAATGTCTGCAA
CTGCGGCACTTTGAGCAGAACTTCCGGGAGGTTAGAGCTC
ACCTAGACCTGGTTTACGACCGACTATCAGGATTCTCCGA
AGTAGGAATCAGCCCGGCCCATGCTGAACACATCCTCAAA
GAACTGACCAATCACGAAGAGAGAGCATCCGAGGTGATGG
ACCAGGCTCTGTCTCTTGCGAGTGATGCAGATCAGCTGAT
TGAAGCGTCTCATTATGCTGTGGACTCCATCCTGCCCAAA
TGCTCTGAGCTGCGCTCTGTGTGTGAGGAGATCAGCACCA
TCCTGAGGGCCAAGAAAGCCTATTTGTTCAAATCCGTGGA
GCTTCACCAGTGTCTGGAGAAGGCCACTAAATGGTATGAT
GATGGAATCTACCTGCTGGCGTCTCAGCCTGTGGATAAGT
GTCAGTCACAGGATGGGGCGGAGTCAGCGCTGCAAGAGAT
TGAACGTTACTTGGATACAGCCAATCAGCACAAGCTAACA
GATTTGAATGGAATTTGGAGGGACTATGATTCCGTACTCA
CACAAGACTTCAGGGATCAGGTTGACAAAGTGTTTCAGAA
GCAGCTGTCCATGCAGGAAATGTTTGAGAAGAGAAGGGTC
AGTCTGAAGAAGCTAGCAGCTAAACAAACTCGACCCGTGC
AGCCTGTCGCTCCACGTCCTGAAGCCATCATCAAAACACC
AGTCTCATCTCCAGCTCATAGAGAGAAGTCTATAGAAGGC
GACGTCATCAATGGAAACTGCAAAAAAGGAGAGCTGCATT
TACAGAACGAGGGCAGCAGCAGACACCCGTCCGTCTCTGA
TGAAGAGGAGAACTTCGCTGTGCTCAGACGGCACGTGATG
AACGAGCTGCTGGAGACAGAGAGAGCGTATGTGGAGGAGC
TGCTGTGCGTGTTGGAGGGTTATGCAGCAGAAATGGACAA
TCCTGCCATGTCTCACCTCATCCCCAACACACTGCTTCAC
AAGAAGGACATCCTCTTCGGAAACATGTCTGAGATCTACC
AGTTCCACAAGAAGACTTTTCTTCGTGAACTGGAGGCTTA
CACAGATTATCCTGAGCTTGTGGGACAGTGTTTCTTGGAA
AGAATGACAGATCTGCAGATTTATGAGAAGTACTGTCAGA
ACAAACCTCGCTCAGAGTCTTTATGGAGACAGTGCTCTGA
CTGCGCTTTCTTCCAGGAGTGTCAAAAGAAACTGGAACAT
AAGCTTGGTCTGGACTCATACCTGCTGAAACCTGTGCAGA
GAATAACCAAATACCAGCTTTTACTAAAGGAGCTGCTGAA
GTACAGTAAAGGCTGTGAGGGTGAGGAGGACCTACAGGAG
GCGCTCTCATCCATTCTTGGCATCCTAAAAGCTGTGAACG
ACTCTATGCACCTCATCGCCATCACTGGATACGAAGGTAA
CCTCAGTGATCTGGGCCGTCTGATGATGCAGGGCTCCTTC
AGCGTGTGGACGGAGCATAAGAAGGGTCACGCCAAGGTAA
AAGACCTGGCACGATTCAAGCCCATGCAGAGACACCTGTT
CCTGCACGAGAAAGCTCTGCTCTTCTGTAAGAAACGAGAG
GAGAACGGGGAGGGTTATGAGAAAGCCCCGTCATACAGCT
TCAAACACTCGCTCAGTATGAGTGCTGTGGGTATTACAGA
GAACGCCAAAGGAGACAACAAAAAGTTTGAGATCTGGTGT
AATTCTCGAGAGGAAGTGTATATTGTGCAGGCATCAACAC
CAGAGATCAAAACAGCATGGGTGAATGAGATCCGGAAGGT
TCTGACAAGGCAGCTAAAGGCCTGCAGGGAGGCGAGCCAG
CAGAAGAGCTCCGATCAGATCTCCCCATTAACTCCCAGCA
GCACCGGCCTGACCCTGAGCCCCTTCAAAACAAACCCAAA
GAGCCTGAAGAAAGGAGACGAGAAGAAAACAGAACCCACG
ACCACAGATCCCAGCTCAGCCGCCTTATTCAAAAACAACG
ACAAGCTCAAAGACGAGACTGTCGTCAGTCCCAACACTGA
GAGAGCTGCAGTGGCTAAAAAGCGCTTTACACTGCAGGGC
TTCAGTAACCTCAAGAGTCAAAAAGGATCATCCCCCCCTA
GTCCCGACCACAAAACTAAAAGACAGAGTGATCCTACACC
GTTTGGCTTCAGAGGCTTCACCAAGGCGTCGCTGTCTATG
GATGCGTCTGAAGAAAACGACGGATACTCGAGCGCCGAGG
ACCCCATGAACTCTGACCCTGAGGATGAGGGAGGGAAGAA
ATTGTCTCCAGGCAAGTACGTAGTGGTTGCTGACCATGAC
AAAAGTGGACCACAGGAGCTGACTGTTAAGAGCGGAGACA
CTGTGCAACTGGTCCGAGAGGGAGACGATGGACGCTGGTT
TGTTCGTAACCTGCGGACCAGCAAAGAGGGCTGGGTTCCT
GCTGCAAACCTGCTCACGCTCATCGGAGAGTCCAAATCTT
CTCAGTCTCTCTCCAGCTCAGAAGGCAGTGGGTCTGGAAA
CCTCAGTACATCGTCCAGCTGCAGTGAAACCTACACAAGC
TTCTCGGACATTAAAGCCTGATGTTAAAGCCCCTGCGCCT
GGCTCCTGGCAGCTCTACACACTGCACTTTCTACTCAAGC
TCTAGTCTCCGTACTGTATTTAATCTCTTCGCCAGAGAAA
GATTGGCCGTCTATACGCGCCATTCAGGATATTTTATACC
GAGCGCCTCTCGTTCACAAGCTTCTCTCCTTCATAAGAGA
GAGAAGAAGGAAACTGTGATTCAGTGTTTGCTGTTCCCAT
TCGATCTCTCCTTTCCTTTGAAAGTATCATTGTGATGCTG
TTTGTTTGGCGTCTGCATGCATTTCCTCAAAGATTCAAAG
GGTTTTTGGTGGAGTCGGCGTTAAGATCAGAGTAGCCTGC
GGTTTTAACTGTACATTACGAGGACTTTAAATGTACGATC
ACATGAGCTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations