header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-444
Transcript Name: cdk13-003
Previous Names: nrp1a-001, dkey-192l18.6-003, ottdart00000044171

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044171 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044171|OTTDARG00000031704|ZDB-GENE-030131-4975 cdk13|no_translation DKEY-192L18.6-003 LG_ BX005461.9 Danio rerio protein_coding NOVEL, 834 bp
TAAACTGTTCGCCCTCCTGTGATTTGTTTCTTCATGAAGT
ATTTCCCAAATGATGTTGAACAGATGCAGGACTCGTTCAC
AGTGTTTCCTCTAATGTTTGTTCTCCTGGAGAAAGTCTTA
TTTGATTTATTTCGGCTAGAATAAAAGCAGGTTTAATAGT
TTTAAAGCCATTTTAAGCTCGATATTATTCGCCCCCTTAT
GCAATATCAGTGTTGGATTGTCTCCAGAGCAAACCACTGT
TATACAATGACTTGCCTAATTACCCTAACTTCACCCTGAT
TACCCCAGTGAAGCCTTTACATGTCGCTTTAAACAGCATT
ACACGTTATTATTCTTCATGTTTTTGTCAGTGTCAGCAGT
TTAAAGGAGTCTTCAGCAGGGAAGAAGAGCTCTAAACCGG
AGAGGAAAGTCCGTGCGCTGCTGTCAGATCTTCCTCTTCC
TCCGGAGCTGCCGGGACTCACGCCTGCGTCTCCGCTCAGC
CCGCCAGACGAGAAGAAGACGCCCGCTCCACGCCGCAGAC
CCAAAATCTGCGGGCCGCGCTTCGGGGAGATCAAGGAGAC
GGAGATCGACTGGGGGAAACGCTGCGTCGACAAATTCGAG
ATCATCGGCATCACTGGAGAGGGTACTTACGGCCAGGTGT
ACAAGGCCAAGGATAAAGACACTGCTGAGTTGGTGGCGCT
GAAGAAGGTGCGTCTGGACAATGAGAAGGAGGGTTTCCCC
ATCACCGCCATCCGGGAGATCAAGATCCTGCGGCAGCTCA
ACCACAAGAGCATCATCAACATGAAGGAGATCGTCACCGA
CAAGGAGGACGCCTTAGACTTTAAGAACGATAAA

cdk13 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA cdk13-002 (1) 599
cdk13-003 834
mRNA cdk13-201 (1) 5121
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdk13-003 Contained in:
OTHER cdk13-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000044171 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CA476318 (1) 925bp
    CITATIONS (1)