header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-1895
Transcript Name: cdk13-002
Previous Names: dkey-192l18.6-002, dkey-225n22.1-001, ottdart00000044170

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044170 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044170|OTTDARG00000031704|ZDB-GENE-030131-4975 cdk13|no_translation DKEY-192L18.6-002 LG_ BX005461.9 Danio rerio protein_coding NOVEL, 599 bp
GTGTCCCGCTCCCGCAGTCGTCCCTCCAGCCTGTCGCCCA
GCTCGCTGACCCTGAAGAGCAGCCTGGCCGCGGAGCTCAG
CAAGCAGAAGAAGGCCAAAGCGGCAGAGACGCTAAACTGA
AGGAGGAGAAGAAGAAACAGGCCGTAAAGGAGAAGGAGAA
GACCGTCGCTCCGGTTGTAGCCACACACACACCCGCAGCC
AACAACATGGAGCATCTGGAGGCCAACGACAGTGTCAGCA
GTTTAAAGGAGTCTTCAGCAGGGAAGAAGAGCTCTAAACC
GGAGAGGAAAGTCCGTGCGCTGCTGTCAGATCTTCCTCTT
CCTCCGGAGCTGCCGGGACTCACGCCTGCGTCTCCGCTCA
GCCCGCCAGACGAGAAGAAGACGCCCGCTCCACGCCGCAG
ACCCAAAATCTGCGGGCCGCGCTTCGGGGAGATCAAGGAG
ACGGAGATCGACTGGGGGAAACGCTGCGTCGACAAATTCG
AGATCATCGGCATCACTGGAGAGGGTACTTACGGCCAGGT
GTACAAGGCCAAGGATAAAGACACTGCTGAGTTGGTGGCG
CTGAAGAAGGTGCGTCTGGACAATGAGAAGGAGGGTTTC

cdk13 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA cdk13-002 599
cdk13-003 (1) 834
mRNA cdk13-201 (1) 5121
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdk13-002 Contained in:
OTHER cdk13-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000044170 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AW422874 (1) 599bp
    CITATIONS (1)