header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-1173
Transcript Name: cdk13-201
Previous Names: cdk13-001, ch211-9a18.5-001, dkey-192l18.6-001, ottdart00000044169

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044169 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044169|OTTDARG00000031704|ZDB-GENE-030131-4975 cdk13|OTTDARP00000034980 DKEY-192L18.6-001 LG_ BX005461.9 Danio rerio protein_coding NOVEL, 5121 bp
CTTGTTAGTGAGTCGGTGCGAGAGGGCGACAAGAAGTTTC
AACCCCGCATGAGCGTGTGTGGATTTAGCTAACGTTTTCG
ACGGGATCCTCCGTTCGCGAACCTGCCCAGGAGCGAAAAA
CGATACGCTTTTAACGCGTCACCGGCCGGACGGCGCTAAC
CGGGGCATGGAGGCTGATTTGACTGCTGTTGCGCGGCTGA
TCTGCTAAGTTAGCACTGGCTGGCTAACGCAATCTTTTCA
TCATATGCGCGGAACCGGATTATAAATCGAGGATTTCATG
GACATAACTTACCCGAGCCCTGCTGTGGATTTAACCCGCC
GGTGATGGTTATGCGCGATGAAGGATTCGCCGCGGTGGCT
CGCTGTGTGAACGCGCAGACGTTAGCCGCGCCACGCTAGC
GCTTAAAGTGGGTTTCAAATGTTTTGCTTTGTTTGCCGGG
GACTGAAACGCGAGCACTTCGGAGCGAGAAAAGTGGGATA
TTAAATGCCTAACCCGGAGATCGTCGGCCGCGAGGGCCGA
GGCAGAAGCCCTCCGCCGCAGAGGAGCCAGCGCGAGGCGA
GACGGAGCAAGAGCCGCCGGGAGAGGCACCGGGACGGGAA
GGGGCGATCCGCGTCCTCCTCGTCCCGGAGGAAGAGACAC
AAGCGCGGCCGGGAGAAGCAGCTGCAGCAGCCGCAGCCCT
GGCAGCAGCAGGACGCGCTTTACGACGGGGACGCGGGGAC
TTTGGTGGAGTACGACGACGTGAGCTCGCAGTCCGAGCGC
TTCTCCGGCAGCCCGTCGCCCAGAACCGACGCGCTGTCCG
TGGACCGGCTGAGCGAAGCCGAGCTTCAGGACTGCGGCTA
CGAAGCGCCGGCCGGGAGAGAGCACAACTCGTCCTCGCGC
AGGAGAGACGGACCCGCGGAGAGAATCCGTTCCGAAAAGG
ACGCCAAGCGGAACCGGTCCGGCCGCGAGCAGGACGCGGC
GTTCAAATCGCGCAGCGGCGTCAGGAATCACGACAGCAAC
GGCAGGAAGCCGTCGTCCGCTTCCCAAGCGGACAAAAAGG
AGTCCAGGCGACACAAAAGCAAGCCCAAACCCGAGAAGGA
CGCTCCGTCCGCCTACAGGGAACCGCCGCAGGCGTACAGG
GACGACCGGGAGGAGCTCAGGGCCTACCGGAGGAGCAGTC
CCAGCTTCAAGGCGACGGCGGATAACGCGAGTCCTTACGG
GACGTCTTATTATGGATACCAGTCTCCCCCGGCGAACTAC
CAGCTGATTCCTTGGAGGAGCCCTAAGAAACAGTCTCCTA
CCTCGACCTACTATCGGGACCCGGAGATGTACGCTGCCTA
TAACGCGTTGAACTCGAGCGGCAAGCGGAAGCGTTCGCCG
GCCAGCCCGTACTGGCGCCGGTCGCCGAGTTACGGCCGCC
ACAGCCCCTACGAGCAGGGCGAGTTCGCCGGGAGCCCGTA
CGGCCAGCGCAGGCGCTCCCGGAGCCCCACGCCGGACACC
AGGCGGCCGGTGAAGTCTGGCAGCAGGAGCCCGTATCCTT
CAGCCCGTCACTCCCGCTCCCGCTCTCGGCACCGCGTGTC
CCGCTCCCGCAGTCGTCCCTCCAGCCTGTCGCCCAGCTCG
CTGACCCTGAAGAGCAGCCTGGCCGCGGAGCTCAGCAAGC
AGAAGAAGGCCAAAGCGGCAGAAGCGGCCCGCGCCAAAAA
CAGCTCCAGCAACGCCTCCACCCCCACCAAGGGCTCGTCC
TCGTCCTCCAACGCTCCTCAGCCCAGCCCCGTCACCAACC
ACGCAGCCAAGAAGACCAGACCTCCGTCTCCGCCTCCACC
CGAAAAAGGGCCCCGGACTCCAGTGTGCAGCCAGCCGCAG
TCCCCGGTGGAGCGACCTGCGAAGAGGAGCGCGGACGTCC
CGCTGCCCGGCAGAGACGCTAAACTGAAGGAGGAGAAGAA
GAAACAGGCCGTAAAGGAGAAGGAGAAGACCGTCGCTCCG
GTTGTAGCCACACACACACCCGCAGCCAACAACATGGAGC
ATCTGGAGGCCAACGACAGTGTCAGCAGTTTAAAGGAGTC
TTCAGCAGGGAAGAAGAGCTCTAAACCGGAGAGGAAAGTC
CGTGCGCTGCTGTCAGATCTTCCTCTTCCTCCGGAGCTGC
CGGGACTCACGCCTGCGTCTCCGCTCAGCCCGCCAGACGA
GAAGAAGACGCCCGCTCCACGCCGCAGACCCAAAATCTGC
GGGCCGCGCTTCGGGGAGATCAAGGAGACGGAGATCGACT
GGGGGAAACGCTGCGTCGACAAATTCGAGATCATCGGCAT
CACTGGAGAGGGTACTTACGGCCAGGTGTACAAGGCCAAG
GATAAAGACACTGCTGAGTTGGTGGCGCTGAAGAAGGTGC
GTCTGGACAATGAGAAGGAGGGTTTCCCCATCACCGCCAT
CCGGGAGATCAAGATCCTGCGGCAGCTCAACCACAAGAGC
ATCATCAACATGAAGGAGATCGTCACCGACAAGGAGGACG
CCTTAGACTTTAAGAACGATAAAGGCGCGTTTTACCTGGT
GTTCGAGTACATGGACCACGACCTGATGGGCCTGCTGGAG
TCGGGCCTGGTGCACTTCAACGAGAGCCACATCAAGTCCT
TCATGCGGCAGCTGCTGGAGGGCCTGGACTACTGCCACAA
GAAGAACTTCCTGCACAGAGACATCAAGTGCTCCAACATC
CTGCTCAACAACAAGGGTCAGATCAAGCTGGCAGACTTTG
GACTGGCTCGCCTGTATAACTCTGAGGAGAGTCGACCCTA
CACCAATAAGGTGATCACACTGTGGTACCGGCCACCAGAG
CTGCTGCTGGGAGAAGAGCGATACACACCGGCCATCGACG
TCTGGAGCTGCGGGTGCATTCTGGGAGAGCTTTTCACAAA
GAAGCCCATCTTCCAGGCCAATCAGGAGCTAGCGCAGCTG
GAGCTCATAAGTCGTATCTGCGGCAGCCCCTGCCCTGCCG
TGTGGCCGGACGTCATCAAACTGCCCTACTTCAACACCAT
GAAACCAAAGAAACAGTACCGGCGGCGGCTGCGGGAGGAG
TTCGCTTTTATTCCCCTGATGGCTCTGGATTTGTTCGATC
ACATGCTGGCTCTGGACCCCAGCAAACGCTGCACTGCAGA
ACAGGCCCTGAACAGCGACTTCCTCCGAGACGTGGATCCC
GCCAAGATGCCTCCACCCGACCTCCCCCTGTGGCAGGACT
GTCACGAGCTGTGGAGTAAGAAGCGGCGGCGGCAGAAACA
GATGCCGGAGGAGCTGACGGCCCCTAAAGCCCCTCGCAAA
GAGCTGGGTCTGGACGACAGCCGCAGCAACACACCGCAGG
GATTCGGCACCGCCGCGGGAGGACACAAACCGCAGGGCAG
CGCAAACGCTGCGGGCCTACTGGACCCCAAATCGGCCAAC
TCTCAGCTGACTCAGGATCAGCTGGCGGTGTTGCTGAATC
TGCTGCAGTCCAAGAGCTCTGCGGCGGGGGGATCCGCTCA
GTTCATGCAGACCGTGAGCTCCAAGATGAACCCTGAGACG
CTGCAGCAGCTGAGCAAAGCCCTGCCGTGCGGCCTGCCGG
AGTCCGAGCGTCCCCCGGAGCCGCCCGCGCTCCCCAAAAC
CTCTAAAGCCCTCCCGGCGGCCGCGTCGGGGCCCGGAGCG
CCCCGCACTCCGCCCATGCCCAAACCTCCGTCTCCGCCCG
GCCCGCAGCAGGCCGACGGAGAGAGCTCGGCCTCCGCCAC
GCAGACCGCCGTCACCATGCTGCTGGCTCAGCTGCTGAAC
GTCCAGCAGGGGGCGCCGGGGGACGGGACGGGCTTCGACG
GAGCGGACGGAGGAGTCCCCAATACGGCTCCGGCGCCGCC
GGAGATCAGACAGCCGCCGGAGCCCAGCCCCGTGTCTCCG
GATGCGGAAGGCGGCGGCGTCCCGTCCTCCGGGACTCTGG
ACTCTCTCTCCATTCTCCCGCCGGACCAGAGACCCCCGGA
ACCCCCGGAACCTCCGCCCTGCGCCGACCTGGACTACCGG
CACGCCCCCGAGAGCCGACCGGCGGAACCTCCTCGACCCC
CGGAGCCGGACTATCCTCCGGACGGATCGGGATACGGGGG
AGATTTCGGCCGGCCCCCGCCGCCGTTCCCGCACGCGGGC
TTCTCGGACAGCTACCTCGGCCGCATGATGGGGGCCGGCC
TGCCTCCGCACGCGCCGCTGGGCCCGGAAGCCTTCGCTCG
CGGAGATCATGGCATGGTGTTCAGCGGAGATCAGGACCAT
CGGTTCGAGTACAATCACGGGCCGCCGCCGCCCCCGCCGG
GACAGCCCTGGACTTCCCCGTCCCAATCGCTGGGGTACGC
GGCGGCGCTGCGGGGTCGAGGACTGCCTTTTTGATGCCCC
GCGGAGAGAGAACCGACCGACCCCGAACGCCTCGGAGAAA
AGAAAGACTCCGAAAGAGGCGCGCGGTCGCCCCGAAACCA
GCACTAAACCCGTTTGTAACGTTTGTAAAACCGGAGGGAC
GGACGCGGCGATGGGAACTTTTTTTTGGGATTTCCCGCTC
GCGCCGTTTCGTAGATCCGTTCGGTTTCTCCGGACGGATT
TGGTTTGGTAATCTGTATTCCGCTGCTGTCTTTTAAATTA
AAACCAGACCTTTCTTTGTTTCGGGGGCGTGCGTTCGCCG
CGCGGTAAGTGTTTTTAGCAGCTGCGCGAGGACGGACGGA
CGGAAGGACGGACCTCCAGTATTACGATGTTTTGCACTAC
TGAACAAAGTAGGCGGACGCGAGCGGAGCGCTGTGCCGCA
TCTGCGCGCGTGACGAGCGGCGACGTGAGGCGTTTTATTT
TGGGTCGGTTTCTTTTTCTTTTCTTGATGATTTTTGACCG
CTCCGGGCTCCGCCCGAAGGTTTCGAGGGGTCCGGGGAGA
CCGGCAGCACTTGTGCGATCTGGTGAATCTACTGAACGGA
TCGGCGCTGCGTTTCGTCACCAGCTCTTGTCTATAGCCAT
TGTAAAATCGATAGTTAAAGAGACGTTTGACCTGTTTTTT
GTTTGTTTTTTTTCTCTCGAGGAGACGAGCGACGATGCTT
TCTTTTTTTTTTTTGTTTTGTATGAAGATGTTTTGTCCCC
CTCTTTGGCAGACGTTTATTAAAGAAATGCCAACAACGGA
A

cdk13 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA cdk13-002 (1) 599
cdk13-003 (1) 834
mRNA cdk13-201 5121
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdk13-201 Contained in:
OTHER cdk13-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000044169 (1)
  • Ensembl_Trans:ENSDART00000114544 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CA476387 (1) 1087bp
    GenBank:EH999265 (1) 1057bp
    GenBank:CA476229 (1) 937bp
    GenBank:EL650434 (1) 920bp
    GenBank:CA476258 (1) 873bp
    GenBank:CK143568 (1) 865bp
    GenBank:CD280385 (1) 720bp
    GenBank:CT716742 (1) 674bp
    GenBank:CN511753 (1) 535bp
    GenBank:FP157926 (1) 530bp
    GenBank:EB905504 (1) 379bp
    CITATIONS (2)