ZFIN ID: ZDB-TSCRIPT-091110-421
Transcript Name: paxbp1-205
Previous Names: ch211-153m12.1-004, ottdart00000044100, zgc:158234-005

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044100 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044100|OTTDARG00000027649|ZDB-GENE-070112-2352 zgc:158234|OTTDARP00000034927 CH211-69K21.1-005 LG_ AL929315.8 Danio rerio protein_coding NOVEL, 810 bp
AATGCCCGGCGCTATCAGCAGATCCAGGAGGATCTGGAGG
CCTCCAAAAAGGCCATCCGGGTCCTGGAGGGCTCCTCTGT
AGAGGCCGCAGACAAATATAGATTCTTGCAAGAAATGCGA
GGGTATGTTGGAGACTTGCTTGAGTGTTTGAGTGAAAAGG
TGCCTGTCATTCTGGAGCTAGAGGCCGCCATGCACCAGTT
ACTTCGACAGCGGGCGTCCCGTCTCGTCCAGAGAAGACAG
GATGATATTAAAGATGAATCGTCGGAGTTTTCCAGCCTTT
CAAGTCAGTCCATCTTGAAGGTAAGGCTGTTATGGCCCCT
AACCTGGACTCATTTGGCCGAGATCGTACTGCCTATCTGG
AGCTCGCAAAGCAAAGGAGGATAGCTGAAAGAGAAGCCAG
ACGAACTCGTCGCAGACAAGCTCGTGAGCAGAACGACAAG
AGAGCAGAGCATAAGGAAGGACTGTCTAGTGACGATGAAG
AGACGTCCACTGACATTACCAGCTTCGACTCAGAGAGAGA
GCGCATCTTAAAAGAGTCAAAGAAGGTGTTTGAGGATGTG
GTGGAGGATTTCCATTCTCTGGACAATATCAAATCTCACT
TTGAGACCTGGAGAAAGCTGTATTACAGCTGCTACAGAGA
CGCCTACATTGGATTGTGTCTGCCCAAACTCTTCAACCCT
CTTATTCGGCTGCAGCTTATCTCGTGGTCCCCACTGGAGG
TGGAGTGCTCCAACTTTGAGTACATGCTGTGGTTTGAGTC
TCTGCTCTTCTATGGCTGTGGGGAGCAAAGTGCTCTAAAG
AAAGAGGAAG

paxbp1 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript paxbp1-205 810
mRNA paxbp1-202 (1)    Ensembl 2368
paxbp1-204 (1)    Ensembl 3319
ncRNA zgc:158234-003 (1)    Ensembl 1026
zgc:158234-004 (1)    Ensembl 789
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
paxbp1-205 Contained in:
[BAC] CH211-69K21 (1)

Genome Resources: Vega_Trans:OTTDART00000044100 (1),  Ensembl_Trans:ENSDART00000139332 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK698645 (1) 814 nt
CITATIONS (2)