ZFIN ID: ZDB-TSCRIPT-090929-17726
Transcript Name: paxbp1-202
Previous Name: zgc:158234-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037303 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037303|OTTDARG00000027649|ZDB-GENE-070112-2352 zgc:158234|OTTDARP00000029890 CH211-69K21.1-002 LG_ AL929315.8 Danio rerio protein_coding NOVEL, 2368 bp
GTGGACTTGTTATTATCTCTGGCGCTCTGCAAAAACATAA
AAACCAGTCTGAATATACTCTTCTAGACGCTTCATCACCA
TGTTTAAAAAAGCTAAGAGATGCAATTTCAGGCGGCGGAA
TGACTCGGAGGATGAGGAAAAAGAGGAGCAGCAACAGTCC
GGTGGGCCCGGGGCTGAAGACTCCGCGAGCCCGAGTGAGT
CCGGCAGCGGCCCCGCTCCCGGAGCAAACGTGCTGAACAA
CCACGGAAACGGATTTCAGCCAGGTGCTGTCAAGGCCGTT
AAAGAGAAGAAAAAGAGGAAGGAGATCCGAGAGGAGCCGA
AAGCAAGTCTGCTGAGCTTCCAGGATGATGAAGATGAAGC
AGAAGTTTTCCGTGTGAAGAAGTCCAACCACAGCAAGAAG
ATCGTCAAGCAGCTCAAGAAAGAATACAAGGAGGATTTGG
AGAAGACTGTACCGGAGCAAAGCACTCGTATTGGTGGTCA
GAATCTGACCATTAAAGAGGAGCCCTTAGAGGGCAGCAGA
GCCAGCAGTGAACAAGGAGAAGAAGAAATGGAGGTGGACA
GCAATGAGGATCAGGAGGAGGAGGGTGATCAGAAGTCTGC
AGGTGGAGCGTTTAAAGAAAATCTGTCAGCCCTCAGCTTA
CTCAGACCAGGTGAGATTCCTGATGCAGCCTTCATCCATG
CTGCACGTAAACGTCGTCAGATGGCTCGAGAGCTCGGCGG
AGACACTCCACTGGTCGAGAATGATCCGACAAACAAACGT
CTCGTTCACGAAGATGAAAACGGAGACATGGATGATGATG
AAGATGAAAAGAGAATCGTCTTCAGTGGAGTCAACACGAA
GAGTCAGAGGCAGAAAATAGCAGAGGAGATTGGTATTGAA
GGCAGTGATGATGAAGCTCTAGATAATGGACAGGATGAGG
AAGTGAGCCGTTGGGAGCAGGAGCAGATCAGGAAGGGCAT
TAGCATCCCACAGGTCCAAACCCAGCCTGAAGATACAAGC
ATGTATTACCAGGGCAGTTATGATGCTCAGCCGTATGGTG
CATCCTACGCCATGCCGTTTAACTACGCCACTGCCGTAGC
AGGAGTTGACAATAGCAAACCGCTGAAAGCAGAGCCGTCA
GTTCCCTATCCCATTCCCTCTTGTGAACTGACCCCTATAA
CCACAGATCTGGTAAAGAAACGCCTCCAAGACAGGCTGAG
CTTCATGCGTCAGGGGCACAATACCAATGCCCGGCGCTAT
CAGCAGATCCAGGAGGATCTGGAGGCCTCCAAAAAGGCCA
TCCGGGTCCTGGAGGGCTCCTCTGTAGAGGCCGCAGACAA
ATATAGATTCTTGCAAGAAATGCGAGGGTATGTTGGAGAC
TTGCTTGAGTGTTTGAGTGAAAAGGTGCCTGTCATTCTGG
AGCTAGAGGCCGCCATGCACCAGTTACTTCGACAGCGGGC
GTCCCGTCTCGTCCAGAGAAGACAGGATGATATTAAAGAT
GAATCGTCGGAGTTTTCCAGCCTTTCAAGTAAGGCTGTTA
TGGCCCCTAACCTGGACTCATTTGGCCGAGATCGTACTGC
CTATCTGGAGCTCGCAAAGCAAAGGAGGATAGCTGAAAGA
GAAGCCAGACGAACTCGTCGCAGACAAGCTCGTGAGCAGA
ACGACAAGAGAGCAGAGCATAAGGAAGGACTGTCTAGTGA
CGATGAAGAGACGTCCACTGACATTACCAGCTTCGACTCA
GAGAGAGAGCGCATCTTAAAAGAGTCAAAGAAGGTGTTTG
AGGATGTGGTGGAGGATTTCCATTCTCTGGACAATATCAA
ATCTCACTTTGAGACCTGGAGAAAGCTGTATTACAGCTGC
TACAGAGACGCCTACATTGGATTGTGTCTGCCCAAACTCT
TCAACCCTCTTATTCGGCTGCAGCTTATCTCGTGGTCCCC
ACTGGAGGTGGAGTGCTCCAACTTTGAGTACATGCTGTGG
TTTGAGTCTCTGCTCTTCTATGGCTGTGGGGAGCAAAGTG
CTCTAAAGAAAGAGGAAGACGTGGATAACAACCTGCTTCC
TGCTATTGTAGAAAGAGTGCTGCTTCCTAAACTAGCAGTG
CTAACGGATCAGATCTGGGATCCACTGTCCAACAGCCAGA
CATACAGACTGGTGGCATTCATGAAGAGGCTAGTGAAAGA
CTATCCCACTGTCCTGCACGGCGAAAACCGCAACACACAA
GTCAGTGAACGGATGAGACTGCAGTGCTTTGAAGACTTGA
TTTTAATCTAATCCTTATTTTTAAATCCGCAAGTGTGCTA
TTTTTTGCAATTTGTTTTAGAACTTACGATTCAGTTGCCT
ATAGGAGAAATGACTAGGAATAATAAACGGCTGAAAACAA
TCAAACTA

paxbp1 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript paxbp1-205 (1)    Ensembl 810
mRNA paxbp1-202 2368
paxbp1-204 (1)    Ensembl 3319
ncRNA zgc:158234-003 (1)    Ensembl 1026
zgc:158234-004 (1)    Ensembl 789
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
paxbp1-202 Contained in:
[BAC] CH211-69K21 (1)

Genome Resources: Vega_Trans:OTTDART00000037303 (1),  Ensembl_Trans:ENSDART00000140572 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC129168 (1) 2405 nt
CITATIONS (2)