Transcript

commd3-003

ID
ZDB-TSCRIPT-091110-1967
Name
commd3-003
Previous Names
  • dap1a-004
  • ottdart00000044511
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044511 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044511|OTTDARG00000021395|ZDB-GENE-041219-3 commd3|no_translation commd3-003 LG_ CR376737.4 Danio rerio protein_coding KNOWN, 663 bp
GTCGGAATCAGTGATGAAAGGGCTTCAAATCCTAGCCGAT
TCAAACGTGATCGACCTGAAGTCGTATGCGATATTCACAG
AGGTCGCCTTCAACAGTCTGGTCTCGCCTCGAAGCGAAAG
CGCTCTGGGTCATCCAGAATTGAAACACATCGATCAGTCA
ACTCTGAACCACTGTCACACCGCGGCAACAACGTTCATTC
TTGAGGGAGTTAAGCAAAATGCGGATAAATCGACAATTAG
CTCATGTCTTGAAGACCTGGGGTTTCAGACTGAAAGAGTG
GACATATTTTATACTTCATTCCAAAAAAACAAACAAAATG
TGGAGTCTTTGTTGTCAAGCATTGACATATGCCCTCCCCA
TATAACTGATGCTGCATGGCGTCTTGAATATTGTATAAAG
AATAGTCATGTACATAAAGTCAATCAGCCGTCATACCTGA
TTTCCTTAAACACTGAGGTATGTAATTCCATAAAGCCTAC
ATGCATTCACTGTACTTTCCAGTAATGGTTATTTTCACTT
TGGATGTACTCTGGTTGCTTTTGCAGAGCGGTGGCTGTTC
GTCGAAAATTAAGTTTAACTGCACAATGGAGCAACTTCAG
GATTTGGTTGGAAAAATGAAGGACGCCGCAAAAAGTGTCG
AGAGAGCAACACAGTCATGATTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations