ZFIN ID: ZDB-TSCRIPT-090929-9764
Transcript Name: commd3-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027193 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027193|OTTDARG00000021395|ZDB-GENE-041219-3 commd3|no_translation commd3-002 LG_ CR376737.4 Danio rerio protein_coding KNOWN, 576 bp
CGCTTGTGTTCTAAATTCTGAAAATACCGTGTGTTCTTCT
AGCTCATGTCTTGAAGACCTGGGGTTTCAGACTGAAAGAG
TGGACATATTTTATACTTCATTCCAAGTAGGCTAACGTTT
GGTCTCCCAATATTTTTAAAAGAACAGTTGAATTACAGTA
AGGTGAATATCTCTCTTCTATATATCTTCTAGAAAAACAA
ACAAAATGTGGAGTCTTTGTTGTCAAGCATTGACATATGC
CCTCCCCATATAACTGATGCTGCATGGCGTCTTGAATATT
GTATAAAGAATAGTCATGTACATAAAGTCAATCAGCCGTC
ATACCTGATTTCCTTAAACACTGAGAGCGGTGGCTGTTCG
TCGAAAATTAAGTTTAACTGCACAATGGAGCAACTTCAGG
TATTTATTTTAGTCCACAGACTCACTATCAGTTTGACTAA
AAGCACGTGGATGATTTCCTCCAGCTTAGCCATTGATTAA
GATGTTATTTTTCTAAAGGTTTAAATAGGCTAAAATGCTT
TTATTATTTGAAACAATTTGATGTTTTCACAGTTATTTTC
ATATTTTTGACTCTTC

commd3 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA commd3-002 576
commd3-003 (1) 663
mRNA commd3-201 (1) 780
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
commd3-002 Contained in:
OTHER commd3-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027193 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB938026 (1) 576bp
    CITATIONS (1)