ZFIN ID: ZDB-TSCRIPT-090929-9763
Transcript Name: commd3-201
Previous Name: commd3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027192 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027192|OTTDARG00000021395|ZDB-GENE-041219-3 commd3|OTTDARP00000022279 commd3-001 LG_ CR376737.4 Danio rerio protein_coding KNOWN, 780 bp
GCTGACGCGCTCATGTGACCAAGGCTAGCGAGTTTGCTCA
AAATGGAGTTGTCGGAATCAGTGATGAAAGGGCTTCAAAT
CCTAGCCGATTCAAACGTGATCGACCTGAAGTCGTATGCG
ATATTCACAGAGGTCGCCTTCAACAGTCTGGTCTCGCCTC
GAAGCGAAAGCGCTCTGGGTCATCCAGAATTGAAACACAT
CGATCAGTCAACTCTGAACCACTGTCACACCGCGGCAACA
ACGTTCATTCTTGAGGGAGTTAAGCAAAATGCGGATAAAT
CGACAATTAGCTCATGTCTTGAAGACCTGGGGTTTCAGAC
TGAAAGAGTGGACATATTTTATACTTCATTCCAAAAAAAC
AAACAAAATGTGGAGTCTTTGTTGTCAAGCATTGACATAT
GCCCTCCCCATATAACTGATGCTGCATGGCGTCTTGAATA
TTGTATAAAGAATAGTCATGTACATAAAGTCAATCAGCCG
TCATACCTGATTTCCTTAAACACTGAGAGCGGTGGCTGTT
CGTCGAAAATTAAGTTTAACTGCACAATGGAGCAACTTCA
GGATTTGGTTGGAAAAATGAAGGACGCCGCAAAAAGTGTC
GAGAGAGCAACACAGTCATGATTCCTGGAGGTTGTCTAAC
CAAACGCATCTTTCCGGTTTCTTTTTGTTCTGTTGTTCTT
GCATATCGATTAATATTATCTGGTGCTGTGGTTGTTTGTT
TGTGGTTGTTTTTCCAAAATGTCATTTTCATAAAATCCAC
AATAAATCACTTTTAAGCAA

commd3 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA commd3-002 (1) 576
commd3-003 (1) 663
mRNA commd3-201 780
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
commd3-201 Contained in:
OTHER commd3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027192 (1)
  • Ensembl_Trans:ENSDART00000066764 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK362403 (1) 844bp
    GenBank:BC086852 (1) 794bp
    CITATIONS (2)