Transcript

commd3-201

ID
ZDB-TSCRIPT-090929-9763
Name
commd3-201
Previous Names
  • commd3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027192 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027192|OTTDARG00000021395|ZDB-GENE-041219-3 commd3|OTTDARP00000022279 commd3-001 LG_ CR376737.4 Danio rerio protein_coding KNOWN, 780 bp
GCTGACGCGCTCATGTGACCAAGGCTAGCGAGTTTGCTCA
AAATGGAGTTGTCGGAATCAGTGATGAAAGGGCTTCAAAT
CCTAGCCGATTCAAACGTGATCGACCTGAAGTCGTATGCG
ATATTCACAGAGGTCGCCTTCAACAGTCTGGTCTCGCCTC
GAAGCGAAAGCGCTCTGGGTCATCCAGAATTGAAACACAT
CGATCAGTCAACTCTGAACCACTGTCACACCGCGGCAACA
ACGTTCATTCTTGAGGGAGTTAAGCAAAATGCGGATAAAT
CGACAATTAGCTCATGTCTTGAAGACCTGGGGTTTCAGAC
TGAAAGAGTGGACATATTTTATACTTCATTCCAAAAAAAC
AAACAAAATGTGGAGTCTTTGTTGTCAAGCATTGACATAT
GCCCTCCCCATATAACTGATGCTGCATGGCGTCTTGAATA
TTGTATAAAGAATAGTCATGTACATAAAGTCAATCAGCCG
TCATACCTGATTTCCTTAAACACTGAGAGCGGTGGCTGTT
CGTCGAAAATTAAGTTTAACTGCACAATGGAGCAACTTCA
GGATTTGGTTGGAAAAATGAAGGACGCCGCAAAAAGTGTC
GAGAGAGCAACACAGTCATGATTCCTGGAGGTTGTCTAAC
CAAACGCATCTTTCCGGTTTCTTTTTGTTCTGTTGTTCTT
GCATATCGATTAATATTATCTGGTGCTGTGGTTGTTTGTT
TGTGGTTGTTTTTCCAAAATGTCATTTTCATAAAATCCAC
AATAAATCACTTTTAAGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations