ZFIN ID: ZDB-TSCRIPT-091110-1824
Transcript Name: rpl17-005
Previous Names: ch211-203l7.2-005, ch73-111i17.3-001, ottdart00000043914, zgc:65996-005

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043914 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043914|OTTDARG00000031537|ZDB-GENE-030131-8585 rpl17|no_translation CH211-203L7.2-005 LG_none CU467622.6,BX000991.8 Danio rerio protein_coding KNOWN, 691 bp
AAATGCCGCCATCTTCTGGTGATCTAACACGTACCAATGA
TCGGTATATCTGGACTGAGATCTAATGATTCTGAGGAAAC
CAACAAATTTCCAAGAATCAGCTCAGCAGAGCGGCATGTA
GAAACAGCTCTCCTGAAATCAGCATAACCTAAAGAGCTGG
AATTCACATTGTGCCTAAGGAGAGAATTCTTGCCTTGAAC
AGGAATGACTCCACCTATCAACAACAACTCCCGTTCAGAA
CTATGGCTAGATGAGCCGCCACTGCACCACAGAGCGGGAC
GCCTGCCAAAACGAACTCTGCAACCTCTTTGGTGTGCCCT
TCGGGTCAGCTTACACAGCAGCGCGCCGTTCTGCTGAAAT
CCCTCAATTAATGCAGAGGAGGAGGAATGACTCAAGTGAA
AAAAGCAGTCTCTGGGTTTTGGGTCTGGTGTTCACTTTTT
GACTTTTCCCTGGGCTGCCACGGCCTCCATGGCTTTGCGC
ACTGTTTCCTCGTCTCCCAGGAACTGCATGGGTTTGATGG
GCTTCAGGTCTTTGTCCAGCTCATAGACGATGGGGATGCC
AGTGGGCAGATTCAGCTCCATGATTGCTGCATCTGACATG
CCTGCGGACATAGATATGGTCACAAATACATTGAAAGTAT
TTTATTATACAGCGCTGAGCATAATTGAATACACCTCGTG
TTTTGAAAATG

rpl17 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rpl17-005 691
mRNA rpl17-201 (1) 625
rpl17-202 (1) 825
rpl17-203 (1) 630
rpl17-205 (1) 924
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rpl17-005 Contained in:
OTHER rpl17-005 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000043914 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH542839 (1) 730bp
    GenBank:EH563976 (1) 714bp
    CITATIONS (1)