header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-1100
Transcript Name: rpl17-205
Previous Names: rpl17-004, ch211-203l7.2-004, ch211-71c16.7-001, ottdart00000043913, zgc:65996-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043913 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043913|OTTDARG00000031537|ZDB-GENE-030131-8585 rpl17|OTTDARP00000034805 CH211-203L7.2-004 LG_none CU467622.6,BX000991.8 Danio rerio protein_coding KNOWN, 924 bp
CCATCTTCTGGTGATCTAACACGTACCAATGATCGGTATA
TCTGGACTGAGATCTAATGATTCTGAGGAAACCAACAAAT
TTCCAAGAATCAGCTCAGCAGAGCGGCATGTAGAAACAGC
TCTCCTGAAATCAGCATAACCTAAAGAGCTGGAATTCACA
TTGTGCCTAAGGAGAGAATTCTTGCCTTGAACAGGAATGA
CTCCACCTATCAACAACAGGACATAATAGTGGAAAGTATA
GACTGGAAACATGGCAGAGGCAGAGAGAAGGGAAGAACTG
GACTTGAAGAGGACCTCAAGCTGGGAATCAAACTCAGGTT
GATGGGCGTCGTAATTGAAGCTGCATGAGAGCTTCAGCAG
ATTCCCAGCAGGAGACACGAGAAGCGGCTCGATACTGCGG
AGGACGAGGCTCCAGAGCGGCCCGATCCGTTACCTCTGCA
AAAACACAGCCATCTTAATGGGAACAACGCGAAACTCTCA
AGCATCTCTGAAAATGGTCCGCTACTCTCTCGACCCAGAG
AACCCGACTAAATCATGCAAGTCGAGGGGCTCCAACCTTC
GTGTTCACTTCAAGAACACCCGTGAAACCGCTCAGGCCAT
CAAGGGCATGCACATCCGCAAGGCTAACAAGTACCTGAAG
GATGTGATCGTCAAGCACCAGTGTGTTCCCTTCCGTCGCT
ACAACGGTGGTGTTGGCCGCTGTGCTCAGGCTAAGCAGCA
TGATTGGACACAGGGACGCTGGCCTAAGAAGAGCGCAGAG
TTCCTCCTGCACATGCTGAAGAACGCAGAAAGCAATGCTG
AGCTCAAGGGTTTGGATGTGGACTCTCTGGTGATCGAGCA
CATCCAGGTAAACAAGGCCCCAAAGATGCGGCGACGTACC
TACCGCGCTCACGGACGCATCAACCCCTACATGAGCTCCC
CTTG

rpl17 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rpl17-005 (1) 691
mRNA rpl17-201 (1) 625
rpl17-202 (1) 825
rpl17-203 (1) 630
rpl17-205 924
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rpl17-205 Contained in:

OTHER rpl17-205 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000043913 (1)
  • Ensembl_Trans:ENSDART00000145591 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EE320790 (1) 955 bp
    CITATIONS (2)