ZFIN ID: ZDB-TSCRIPT-091110-1099
Transcript Name: rpl17-201
Previous Names: lmbrd2b-001, rpl17-001, ch211-203l7.2-001, ottdart00000043910, zgc:65996-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043910 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043910|OTTDARG00000031537|ZDB-GENE-030131-8585 rpl17|OTTDARP00000034802 CH211-203L7.2-001 LG_none CU467622.6,BX000991.8 Danio rerio protein_coding KNOWN, 625 bp
CACTTCCTCTTCCCTTCCGCGGCCTGAGAACATCTCTGAA
AATGGTCCGCTACTCTCTCGACCCAGAGAACCCGACTAAA
TCATGCAAGTCGAGGGGCTCCAACCTTCGTGTTCACTTCA
AGAACACCCGTGAAACCGCTCAGGCCATCAAGGGCATGCA
CATCCGCAAGGCTAACAAGTACCTGAAGGATGTGATCGTC
AAGCACCAGTGTGTTCCCTTCCGTCGCTACAACGGTGGTG
TTGGCCGCTGTGCTCAGGCTAAGCAGCATGATTGGACACA
GGGACGCTGGCCTAAGAAGAGCGCAGAGTTCCTCCTGCAC
ATGCTGAAGAACGCAGAAAGCAATGCTGAGCTCAAGGGTT
TGGATGTGGACTCTCTGGTGATCGAGCACATCCAGGTAAA
CAAGGCCCCAAAGATGCGGCGACGTACCTACCGCGCTCAC
GGACGCATCAACCCCTACATGAGCTCCCCTTGCCATATCG
AGATGATCCTCACCGAGAAGGAGCAGATCGTTCCCAAACC
TGAGGAGGAAGTTTCTCAGAAGAAAAAGGTTTCTCAGAAG
AAACTGAAGAAGCAGAAGCTTATGGCTCGGGAGTAAATGT
AAATAAAGTCCAACATTCGTACTAC

rpl17 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rpl17-005 (1) 691
mRNA rpl17-201 625
rpl17-202 (1) 825
rpl17-203 (1) 630
rpl17-205 (1) 924
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rpl17-201 Contained in:
OTHER rpl17-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000043910 (1)
  • Ensembl_Trans:ENSDART00000131366 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN176143 (1) 675bp
    GenBank:CN511896 (1) 671bp
    GenBank:CN501886 (1) 643bp
    CITATIONS (2)