header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-1823
Transcript Name: rpl17-202
Previous Names: rpl17-002, ch211-203l7.2-002, ch73-112l6.1-001, ottdart00000043911, zgc:65996-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043911 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043911|OTTDARG00000031537|ZDB-GENE-030131-8585 rpl17|OTTDARP00000034803 CH211-203L7.2-002 LG_none CU467622.6,BX000991.8 Danio rerio protein_coding KNOWN, 825 bp
TCCGCGGCCTGAGAACGTAAGTGGCAGTATGAATCCACTG
CAGCGATGCTTAAAATAATCCATTTAATATCGCCATCATC
ATAAACATATACATCCAAATATCACATCGACACGTTTAGT
AAACTTATAAACAATAATCTCAGAGAGTATGAATTGATAT
AAGGTATAAATCATGATGATATTTTCTGGAAGGACGAGCG
TCAGTGTTCTGCCATTTTCCAGAGCCCGTGGAGATCTCTG
AAAATGGTCCGCTACTCTCTCGACCCAGAGAACCCGACTA
AATCATGCAAGTCGAGGGGCTCCAACCTTCGTGTTCACTT
CAAGAACACCCGTGAAACCGCTCAGGCCATCAAGGGCATG
CACATCCGCAAGGCTAACAAGTACCTGAAGGATGTGATCG
TCAAGCACCAGTGTGTTCCCTTCCGTCGCTACAACGGTGG
TGTTGGCCGCTGTGCTCAGGCTAAGCAGCATGATTGGACA
CAGGGACGCTGGCCTAAGAAGAGCGCAGAGTTCCTCCTGC
ACATGCTGAAGAACGCAGAAAGCAATGCTGAGCTCAAGGG
TTTGGATGTGGACTCTCTGGTGATCGAGCACATCCAGGTA
AACAAGGCCCCAAAGATGCGGCGACGTACCTACCGCGCTC
ACGGACGCATCAACCCCTACATGAGCTCCCCTTGCCATAT
CGAGATGATCCTCACCGAGAAGGAGCAGATCGTTCCCAAA
CCTGAGGAGGAAGTTTCTCAGAAGAAAAAGGTTTCTCAGA
AGAAACTGAAGAAGCAGAAGCTTATGGCTCGGGAGTAAAT
GTAAATAAAGTCCAACATTCGTACT

rpl17 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rpl17-005 (1) 691
mRNA rpl17-201 (1) 625
rpl17-202 825
rpl17-203 (1) 630
rpl17-205 (1) 924
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rpl17-202 Contained in:

OTHER rpl17-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000043911 (1)
  • Ensembl_Trans:ENSDART00000132882 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT722017 (1) 798 bp
    GenBank:CT626959 (1) 749 bp
    GenBank:EB843058 (1) 413 bp
    CITATIONS (2)