Transcript

npm1a-205

ID
ZDB-TSCRIPT-091110-148
Name
npm1a-205
Previous Names
  • npm1-005
  • npm1a-005
  • dkey-263m6.1-002
  • ottdart00000043091
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043091 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043091|OTTDARG00000019529|ZDB-GENE-021028-1 npm1a|OTTDARP00000034171 npm1-005 LG_ BX005027.13 Danio rerio protein_coding KNOWN, 809 bp
CGTACAGTCACACACAGCCTGCAGACATGGATCTCGAACA
GATGGGTCCCCAAACCTTCCTGTACGGTTGTGAACTGAAA
GCAGGCAAGGATATCACGCCACCGGTTGTTTTCCGTCTGC
GCACTGGTTCTGGTCCAGTTCACATTAGTGGACAGCATCT
TGTTATCATGGGAGGAGATCAGTCTTTTGATGAAGAGGAG
GAGGAGGAGGAAGAAGAGGAAACCGTGATGACATCCAAGA
AGAGGCCAGCGCTGTCAACTCCAAAGCCTTCAAAAAAAAT
GAAGATGGATGAGGAAGATGACGATGATGATGATGAGGAC
GATGATGATGAAGATGACGATGAGGAAGATGAAAGTGAAG
AGGAGTCACCTGTGAAAGAAAAGAAAGCACCAGCGAAACC
AAAGACCCCTACACAGAATGGAAAAGGACCCAAACCCAGT
ACACCTGCTAAACAAACTCCACAAAAGGGCAAGAAGGAAC
AGACACCCAAAACGCCACAAACACCACGGACTTTAGCCGA
TATCAAGTCCAAGATGATGGAGAGTGTAGCAAAGGGTGTG
TCATTACCAAAAGTACAGCTGAAGTTTGAGAACTATGTGA
ATAACTGCTTCAAAGGCACAGATCCAAAGGTTGTTGAGGA
GCTCTGGAAGTGGAGACAGACTGTCAAATAAATGAACTAA
AACGCCTTTTATTTTGCTTAAATTAAGCCCCTTTCCCACA
CGATTTTACTTTTGTTACCTGCAATTTTATGTTTGTTTGT
CCCCATACCTTTCAGTTTTTATGTTAAATCCGTGCCATTC
CTCGAAATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations