Transcript

npm1a-002

ID
ZDB-TSCRIPT-090929-6952
Name
npm1a-002
Previous Names
  • npm1-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024024 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024024|OTTDARG00000019529|ZDB-GENE-021028-1 npm1a|no_translation npm1-002 LG_ BX005027.13 Danio rerio protein_coding KNOWN, 838 bp
CGTACAGTCACACACAGCCTGCAGACATGGATCTCGAACA
GATGGGTCCCCAAACCTTCCTGTACGGTTGTGAACTGAAA
GCAGGCAAGGATATCACGTTTAATCCAGAGGATGATGATT
ATGATCATCAATTATCGGTTAGAATGGCCTGTGTGGATCC
CTCGACAAAAGATGAATTGAATGTTGTGGAGATTGAAGGA
CAAGATTCAGAGGGTCAGAAGGTCAAGGCAGTTCTAGCAA
CACTCAAGCCTTCAACTCTCCCAAGTGTATGTTTGGGTGG
GTTTGAGATCACGCCACCGGTTGTTTTCCGTCTGCGCACT
GGTTCTGGTCCAGTTCACATTAGTGGACAGCATCTTGTTA
TCATGGGAGGAGATCAGTCTTTTGATGAAGAGGAGGAGGA
GGAGGAAGAAGAGGAAACCGTGATGACATCCAAGAAGAGG
CCAGCGCTGTCAACTCCAAAGCCTTCAAAAAAAATGAAGA
TGGATGAGGAAGATGACGATGATGATGATGAGGACGATGA
TGATGAAGATGACGATGAGGAAGATGAAAGTGAAGAGGAG
TCACCTGTGAAAGAAAAGAAAGCACCAGCGAAACCAAAGA
CCCCTACACAGAATGGAAAAGGACCCAAACCCAGTACACC
TGCTAAACAAGTTTGTATATCTCTTTTTCTTCTTGAAAGT
AGAGGTTCATGTTTGTAGTCTGCCTAGCCTTAGTGTTTTA
AAATGATGTTTTATGGAAACAGACTCCACAAAAGGGCAAG
AAGGAACAGACACCCAAAACGCCACAAACACCACGGACTT
TAGCCGATATCAAGTCCAAGATGATGGAGAGTGTAGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations