Transcript

npm1a-204

ID
ZDB-TSCRIPT-090929-6951
Name
npm1a-204
Previous Names
  • npm1-001
  • npm1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024023 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024023|OTTDARG00000019529|ZDB-GENE-021028-1 npm1a|OTTDARP00000019886 npm1-001 LG_ BX005027.13 Danio rerio protein_coding KNOWN, 1615 bp
TCTGTCCCTGGAGCTCAGTGATTGGCTGGACCGGAGGACC
GTCACAGAAGTGGGCGTGATTTACTCGATGTGGGTCAGTG
TGCTCTTCCTGCACTCGTGTTCGCTGACTGCACATTTCAG
CCGACGTACAGTCACACACAGCCTGCAGACATGGATCTCG
AACAGATGGGTCCCCAAACCTTCCTGTACGGTTGTGAACT
GAAAGCAGGCAAGGATATCACGTTTAATCCAGAGGATGAT
GATTATGATCATCAATTATCGGTTAGAATGGCCTGTGTGG
ATCCCTCGACAAAAGATGAATTGAATGTTGTGGAGATTGA
AGGACAAGATTCAGAGGGTCAGAAGGTCAAGGCAGTTCTA
GCAACACTCAAGCCTTCAACTCTCCCAAGTGTATGTTTGG
GTGGGTTTGAGATCACGCCACCGGTTGTTTTCCGTCTGCG
CACTGGTTCTGGTCCAGTTCACATTAGTGGACAGCATCTT
GTTATCATGGGAGGAGATCAGTCTTTTGATGAAGAGGAGG
AGGAGGAGGAAGAAGAGGAAACCGTGATGACATCCAAGAA
GAGGCCAGCGCTGTCAACTCCAAAGCCTTCAAAAAAAATG
AAGATGGATGAGGAAGATGACGATGATGATGATGAGGACG
ATGATGATGAAGATGACGATGAGGAAGATGAAAGTGAAGA
GGAGTCACCTGTGAAAGAAAAGAAAGCACCAGCGAAACCA
AAGACCCCTACACAGAATGGAAAAGGACCCAAACCCAGTA
CACCTGCTAAACAAACTCCACAAAAGGGCAAGAAGGAACA
GACACCCAAAACGCCACAAACACCACGGACTTTAGCCGAT
ATCAAGTCCAAGATGATGGAGAGTGTAGCAAAGGGTGTGT
CATTACCAAAAGTACAGCTGAAGTTTGAGAACTATGTGAA
TAACTGCTTCAAAGGCACAGATCCAAAGGTTGTTGAGGAG
CTCTGGAAGTGGAGACAGACTGTCAAATAAATGAACTAAA
ACGCCTTTTATTTTGCTTAAATTAAGCCCCTTTCCCACAC
GATTTTACTTTTGTTACCTGCAATTTTATGTTTGTTTGTC
CCCATACCTTTCAGTTTTTATGTTAAATCCGTGCCATTCC
TCGAAATGACTTGAAACAACTTGACCTTGTTCAGTCTGCC
TTGTCCTCACCCTCGGTCATGTCATTTGAGTGTGGGGTTA
ACTTGGCTGCAGTATTGCTCAATTATGAAGCTCTGATTTA
TATAAAGATATGTTGGTGGTGCCCGTCCATGTTTTCTTTA
AACTGACATGGAAATGTCTGCATAGCTATCTGGTTAGATC
TGTGATGCGATAATGCAATGTATGAATAGTGGGTTTCAGA
ATGGCCTCAATGTTTAATTCTGGTATTTCAGCAGCAGTTG
ATATTATTTTGTAATTTTCATTCCCTGGAAAGAGTTAAAT
GCCATTGTATGTTCAGGATTGAATGGTCTTCAGATGTCAT
CAATGTATTGTAATGTCACAGACTTTGCAGCCCTGTCTCA
ACAGAATCAGGACTCAGGACATTTCAGATGTGGTTCTGTT
TTTTGACTTTCTGAAATGTTTAAATGCAAATAAAGGATAT
ATTTCACAACTGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations