ZFIN ID: ZDB-TSCRIPT-090929-9610
Transcript Name: uba1-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027021 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027021|OTTDARG00000021287|ZDB-GENE-040426-2009 uba1|OTTDARP00000022146 ube1-002 LG_ CR339046.11 Danio rerio protein_coding KNOWN, 398 bp
AGGAAGAGCCAGCTAACGGCATGCGCGAGACAATGCGCTC
CATGCGCGCATCACGAGCCGGGGATAAAAGAAACCAACTC
ATCCTTGCGGAAAAGTTGGCCACTTCTCCCGTCATATGAT
GTCCAGCTCGCCGCTGTCCAAGAAGCGTCGCGTGTCAGGA
TCAGAGACGAAGACGGGATCCCATTGCTCCTCCTCTAACT
CTGTCAGAACTGAACTGTCACACACACCAGCTAACGGCAT
GGCTAAGAATGGAAATGATGCTGAGATCGACGAGGGCCTG
TACTCCAGACAGCTGTACGTGCTGGGTCATGATGCTATGA
AGCGTATGCAGAGCTCTAATGTTCTTATCTCGGGACTGCG
AGGTTTAGGGGTAGAGATCGCTAAGAATGTCATTCTGG

uba1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA uba1-001 (1) 4223
uba1-002 398
uba1-003 (1) 862
ncRNA uba1-004 (1) 810
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
uba1-002 Contained in:
OTHER uba1-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027021 (1)
  • Ensembl_Trans:ENSDART00000147382 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB782087 (1) 402bp
    CITATIONS (2)