header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9609
Transcript Name: uba1-201
Previous Name: uba1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027020 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027020|OTTDARG00000021287|ZDB-GENE-040426-2009 uba1|OTTDARP00000022145 ube1-001 LG_ CR339046.11 Danio rerio protein_coding KNOWN, 4223 bp
CTGCACATGTTGGTTCTACGCTCATGAACTGAAGAATACT
TGCCGAACTGTTAACGGTACAGGGAATAGCCGGTCAGGCA
ACCGTCCAGCCTCCCCTCACACTGGAAAGTCACGGAGCTC
CCGCCACTTCCAGGGATAAAGTTACAGAAACGATGTCCAG
CTCGCCGCTGTCCAAGAAGCGTCGCGTGTCAGGATCAGAG
ACGAAGACGGGATCCCATTGCTCCTCCTCTAACTCTGTCA
GAACTGAACTGTCACACACACCAGCTAACGGCATGGCTAA
GAATGGAAATGATGCTGAGATCGACGAGGGCCTGTACTCC
AGACAGCTGTACGTGCTGGGTCATGATGCTATGAAGCGTA
TGCAGAGCTCTAATGTTCTTATCTCGGGACTGCGAGGTTT
AGGGGTAGAGATCGCTAAGAATGTCATTCTGGGTGGAGTC
AAAAGCGTCACCCTGCACGATCAGGGAGTGGCCGAGTGGA
AGGACCTTTCATCACAGTTTTACCTGCGTGAGGAGGATCT
TGGGAAGAACCGTGCTGATGTCAGTCAGCCTCGACTGGCA
GAACTGAACAGTTATGTGCCTGTAACCTCCTACACTGGCA
CCCTCACCAATGAATACCTGACCAAATTTCAGGTTGTTGT
GCTCACCAACTCTAGTCTTGATGAACAGACACGTATCGGG
GAATTTTGCCACAGTAATGGCATCAAGTTGATTGTGGCAG
ACACACGTGGACTGTTTGGGCAACTGTTCTGTGATTTTGG
GGAGGAAATGATAGTATTCGACACAAACGGAGAACAGCCA
TTGAGCGCCATGATCTCAATGATCACAAAAGACAGCGCTG
GTGTGGTTACGTGTCTGGATGAAGCACGGCACGGATTTGA
GAGCGGAGACTATGTCACTTTCACAGAAGTGCAGGGCATG
ACGGAACTTAATGGCTGTGATCCAGTAGAGATCAAGACAC
TGGGTCCTTACACTTTCAGCATCTGTGACACCAGCTCATT
CTCTGACTATGTGAGAGGTGGTATTGTCACACAAGTGAAG
ATGCCCAAGAAGATTGCCTTTAAATCCCTGTCCTCCTCCA
TGGCCGAACCAGAGTTCTTGCTGACTGATTTTGCCAAATT
TGATCGTCCAGGCCAACTCCACGTGGGCTTTCAGGCACTG
CATGCATTTGAGAAGAAGCACAGTCGTCTGCCAAAGCCCT
GGAATCAGGCAGATGCGGATGAGCTTATGACTCTGGCTGA
AGAGGTGAATGCTGCACAGACAGGATCTGCCAAGCAAGAG
GAGCTGGACCAGGCAGTCATAAAAAAGCTGGCCTGCGTGG
CTGCTGGAGACCTGGCACCCGTCAATGCCTTTATTGGTGG
GCTTGCTGCCCAGGAGGTTATGAAGGCCTGCACAGGGAAG
TTTATGCCCATCATGCAGTGGCTGTATTTTGATGCTTTGG
AGTGCTTACCTGAGCCTGAGGAAGTCATTCTTACAGAGGA
AGAGTGTGCTCCTAGGAACTGCCGGTATGACGGCCAGATT
GCCGTCTTTGGGTCCAAGCTGCAGGAGCTGTTAGCCAAGC
AGAGATATTTTCTGGTTGGTGCTGGAGCCATTGGCTGTGA
GCTGCTGAAGAACTTTGCTATGATGGGCTTGGCCAGTGGT
GAAGGAGAGGTCATAGTCACTGACATGGACACCATTGAGA
AGTCCAATCTCAATCGACAGTTCCTCTTCAGACCCTGGGA
TGTCACGAAGATGAAGAGTGAGACTGCTGCTGCGGCAGTG
AAGCAGATGAACCCGTCAGTCCGTATCACTGGTCACCAGA
ACCGTGTGGGACCGGACACGGAGAAGGTCTATGATGATGA
CTTTTTTGAATGCCTTGATGGAGTGGCAAATGCTCTTGAC
AATGTAGATGCCCGTATGTATATGGATCGGAGGTGTGTGT
ACTACCGTAAGCCATTGCTGGAGTCTGGTACTCTTGGCAC
CAAAGGAAACGTGCAGGTGGTCATTCCCTTCATCACAGAG
TCCTACAGCTCCAGCCAGGATCCTCCAGAGAAGTCCATTC
CTATCTGCACACTCAAGAACTTCCCAAATGCAATCGAACA
CACCCTACAGTGGGCTCGTGATGAGTTTGAGGGACTGTTC
AAGCAACCTGCTGAAAACGCCTTGCAGTATCTGACAGACT
CAAAGTTTATGGAGCGCACACTGAAGCTCCCTGGAGCTCA
GCCGCTGGAGGTGGTGGAATCGGTTTACAAGAGTCTGGTG
ACAGACAGGCCACGCAACTGGGATGACTGTGTAACCTGGG
CCCGCAACCACTGGCAGTGTCAATATAACAATAACATCCG
TCAGCTGCTGCACAATTTCCCCCCAGACCAGCTTACAAGC
TCTGGGGCGCCATTCTGGTCAGGTCCAAAGAGATGTCCTC
ATCCATTAGAATTCAGCACTAACAATGATCTTCACATGGA
CTACATTTTGGCAGCAGCTAACTTGTATGCCCTGTCATAC
GGCCTGCCATCCTGCAATGACCGCTCAGCTCTGACCAAGC
TTTTGCAGGATATTAAAGTGCCTGAGTTCACACCCAAGTC
AGGAGTCAAGATTCACGTGTCTGATCAGGAGCTGCAGAGT
GCCAACGCATCAGTCGATGACTCGAGGCTCGAAGAGCTGA
AGACACTGTTGCCTTCTTTAGAAGCATCTTCTCAATTCAA
GCTCTGTCCTATTGAATTTGAAAAGGACGATGACACAAAC
TTCCACATGGACTTCATTGTAGCGGCATCTAATCTGAGAG
CAGAGAACTATGACATTCCTCCTGCAGACAGACACAAGAG
CAAACTCATTGCTGGAAAAATCATTCCAGCCATTGCCACA
ACAACAGCCGCTGTTGTAGGTCTGGTGTGTCTGGAGTTGC
TGAAGATCGTTCAGGGGCACAAGAAGCTCGAGTCCTACAA
AAATGGCTTCATGAACCTTGCTCTGCCTTTCTTTGCCTTC
TCCGAGCCTATAGCTGCCCCCAAGCACAAGTACTACGAGA
TTGATTGGACACTTTGGGACCGTTTTGAGGTGAAGGGCAT
TCAGCCTAATGGAGAGGAAATGACACTCCGGCAGTTCCTG
GATTATTTCAAGAATGAACACAAACTGGAGATCACGATGC
TCTCTCAGGGAGTTTCTATGCTCTACTCTTTCTTCATGCC
TGCAGCCAAACTCAAAGAAAGACTGGAACTACCGATGACT
GAGATCGTGACCAAAGTGTCCAAGAAGAAACTGGGCAAGC
ATGTCAAAGCACTAGTGTTTGAGCTCTGCTGCAATGACGA
CACAGAAGAAGACGTAGAGGTGCCCTATGTCAGATACACC
ATCCGCTGACAGGGCTGATGGGTAGGACAGGGGACAGACT
AGAGGAGGGAGAGGGCGGCCCACTGGGGATGGGAGTGCAT
CAGTATGCTTGGAGAGCCCAAATCAAATCAATTGGTTTTA
TTTTAACCTGATGCTCAAGTATTATCTATCAATAACCTCT
TTTACCCTGCCGGTCGAGCTCTTTAAGGTCTAATTCAGTC
AGGTTGGTCATGTTCAGGAAATGGGGAGCATGTGAAGTTT
TGGCTGTAACTTATTTAAGCTGGTTTTTGTAACGCACAGC
ATCAGTGTGTGAATTTTATCATCACTCCCTTTCTGTGAAT
CCTCTTTCTCACACCGGTCCTCATGTGGGCAGCACCATCT
TGATTTGTTTTCCTGAATAAAATATTGACTGATGCCAAAA
AAAAATGAGTACAAATGGAAAAGATGTCAATGATGTTTGC
TTAAATAGATTTTTCAAATCATCGCCTTGGCTTGATGTCA
CCTTAAATGTAACTTGAAATGCGCTCTTATTGGCCAAGGT
TTTGGAGCAACGTACTGAACTCCTGTTCTCCCATTGGCCC
AGTGGGAACCTCCCTTTGCCTCTCTGGCTTCTGTATGGGG
TGGGTACAGGAACTTGCACATAACTTTTTGTTTTGTTTTT
CCCTCATTTTTTTATTTTTATTTTTTTGGCAGAATTCTGG
TGTACACCTTGTAGAACATAACCTCTGTATTCTTTCTACT
TTGTTAAACTCCAAAAAAAGACATTACAGTCTAAAACACA
TGATTTTACTCTGTAATGGGAGCACTTAGTGTGTTAGTGA
ATAAAGTTGGAAACGTTTTCTTTGCTTTATTGTCTCCTCT
TTGCTATTGTTGTTTTTAAGATGTGTCTAAACAGTTAATA
AAAACAGTCTTAGGTCAATCAAA

uba1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA uba1-004 (1) 810
mRNA uba1-201 4223
uba1-202 (1) 862
uba1-204 (1) 398
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
uba1-201 Contained in:

OTHER uba1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027020 (1)
  • Ensembl_Trans:ENSDART00000054691 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC060674 (1) 4156bp
    GenBank:EB791483 (1) 587bp
    GenBank:BM025863 (1) 560bp
    CITATIONS (2)