Transcript

uba1-201

ID
ZDB-TSCRIPT-090929-9609
Name
uba1-201
Previous Names
  • uba1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027020 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027020|OTTDARG00000021287|ZDB-GENE-040426-2009 uba1|OTTDARP00000022145 ube1-001 LG_ CR339046.11 Danio rerio protein_coding KNOWN, 4223 bp
CTGCACATGTTGGTTCTACGCTCATGAACTGAAGAATACT
TGCCGAACTGTTAACGGTACAGGGAATAGCCGGTCAGGCA
ACCGTCCAGCCTCCCCTCACACTGGAAAGTCACGGAGCTC
CCGCCACTTCCAGGGATAAAGTTACAGAAACGATGTCCAG
CTCGCCGCTGTCCAAGAAGCGTCGCGTGTCAGGATCAGAG
ACGAAGACGGGATCCCATTGCTCCTCCTCTAACTCTGTCA
GAACTGAACTGTCACACACACCAGCTAACGGCATGGCTAA
GAATGGAAATGATGCTGAGATCGACGAGGGCCTGTACTCC
AGACAGCTGTACGTGCTGGGTCATGATGCTATGAAGCGTA
TGCAGAGCTCTAATGTTCTTATCTCGGGACTGCGAGGTTT
AGGGGTAGAGATCGCTAAGAATGTCATTCTGGGTGGAGTC
AAAAGCGTCACCCTGCACGATCAGGGAGTGGCCGAGTGGA
AGGACCTTTCATCACAGTTTTACCTGCGTGAGGAGGATCT
TGGGAAGAACCGTGCTGATGTCAGTCAGCCTCGACTGGCA
GAACTGAACAGTTATGTGCCTGTAACCTCCTACACTGGCA
CCCTCACCAATGAATACCTGACCAAATTTCAGGTTGTTGT
GCTCACCAACTCTAGTCTTGATGAACAGACACGTATCGGG
GAATTTTGCCACAGTAATGGCATCAAGTTGATTGTGGCAG
ACACACGTGGACTGTTTGGGCAACTGTTCTGTGATTTTGG
GGAGGAAATGATAGTATTCGACACAAACGGAGAACAGCCA
TTGAGCGCCATGATCTCAATGATCACAAAAGACAGCGCTG
GTGTGGTTACGTGTCTGGATGAAGCACGGCACGGATTTGA
GAGCGGAGACTATGTCACTTTCACAGAAGTGCAGGGCATG
ACGGAACTTAATGGCTGTGATCCAGTAGAGATCAAGACAC
TGGGTCCTTACACTTTCAGCATCTGTGACACCAGCTCATT
CTCTGACTATGTGAGAGGTGGTATTGTCACACAAGTGAAG
ATGCCCAAGAAGATTGCCTTTAAATCCCTGTCCTCCTCCA
TGGCCGAACCAGAGTTCTTGCTGACTGATTTTGCCAAATT
TGATCGTCCAGGCCAACTCCACGTGGGCTTTCAGGCACTG
CATGCATTTGAGAAGAAGCACAGTCGTCTGCCAAAGCCCT
GGAATCAGGCAGATGCGGATGAGCTTATGACTCTGGCTGA
AGAGGTGAATGCTGCACAGACAGGATCTGCCAAGCAAGAG
GAGCTGGACCAGGCAGTCATAAAAAAGCTGGCCTGCGTGG
CTGCTGGAGACCTGGCACCCGTCAATGCCTTTATTGGTGG
GCTTGCTGCCCAGGAGGTTATGAAGGCCTGCACAGGGAAG
TTTATGCCCATCATGCAGTGGCTGTATTTTGATGCTTTGG
AGTGCTTACCTGAGCCTGAGGAAGTCATTCTTACAGAGGA
AGAGTGTGCTCCTAGGAACTGCCGGTATGACGGCCAGATT
GCCGTCTTTGGGTCCAAGCTGCAGGAGCTGTTAGCCAAGC
AGAGATATTTTCTGGTTGGTGCTGGAGCCATTGGCTGTGA
GCTGCTGAAGAACTTTGCTATGATGGGCTTGGCCAGTGGT
GAAGGAGAGGTCATAGTCACTGACATGGACACCATTGAGA
AGTCCAATCTCAATCGACAGTTCCTCTTCAGACCCTGGGA
TGTCACGAAGATGAAGAGTGAGACTGCTGCTGCGGCAGTG
AAGCAGATGAACCCGTCAGTCCGTATCACTGGTCACCAGA
ACCGTGTGGGACCGGACACGGAGAAGGTCTATGATGATGA
CTTTTTTGAATGCCTTGATGGAGTGGCAAATGCTCTTGAC
AATGTAGATGCCCGTATGTATATGGATCGGAGGTGTGTGT
ACTACCGTAAGCCATTGCTGGAGTCTGGTACTCTTGGCAC
CAAAGGAAACGTGCAGGTGGTCATTCCCTTCATCACAGAG
TCCTACAGCTCCAGCCAGGATCCTCCAGAGAAGTCCATTC
CTATCTGCACACTCAAGAACTTCCCAAATGCAATCGAACA
CACCCTACAGTGGGCTCGTGATGAGTTTGAGGGACTGTTC
AAGCAACCTGCTGAAAACGCCTTGCAGTATCTGACAGACT
CAAAGTTTATGGAGCGCACACTGAAGCTCCCTGGAGCTCA
GCCGCTGGAGGTGGTGGAATCGGTTTACAAGAGTCTGGTG
ACAGACAGGCCACGCAACTGGGATGACTGTGTAACCTGGG
CCCGCAACCACTGGCAGTGTCAATATAACAATAACATCCG
TCAGCTGCTGCACAATTTCCCCCCAGACCAGCTTACAAGC
TCTGGGGCGCCATTCTGGTCAGGTCCAAAGAGATGTCCTC
ATCCATTAGAATTCAGCACTAACAATGATCTTCACATGGA
CTACATTTTGGCAGCAGCTAACTTGTATGCCCTGTCATAC
GGCCTGCCATCCTGCAATGACCGCTCAGCTCTGACCAAGC
TTTTGCAGGATATTAAAGTGCCTGAGTTCACACCCAAGTC
AGGAGTCAAGATTCACGTGTCTGATCAGGAGCTGCAGAGT
GCCAACGCATCAGTCGATGACTCGAGGCTCGAAGAGCTGA
AGACACTGTTGCCTTCTTTAGAAGCATCTTCTCAATTCAA
GCTCTGTCCTATTGAATTTGAAAAGGACGATGACACAAAC
TTCCACATGGACTTCATTGTAGCGGCATCTAATCTGAGAG
CAGAGAACTATGACATTCCTCCTGCAGACAGACACAAGAG
CAAACTCATTGCTGGAAAAATCATTCCAGCCATTGCCACA
ACAACAGCCGCTGTTGTAGGTCTGGTGTGTCTGGAGTTGC
TGAAGATCGTTCAGGGGCACAAGAAGCTCGAGTCCTACAA
AAATGGCTTCATGAACCTTGCTCTGCCTTTCTTTGCCTTC
TCCGAGCCTATAGCTGCCCCCAAGCACAAGTACTACGAGA
TTGATTGGACACTTTGGGACCGTTTTGAGGTGAAGGGCAT
TCAGCCTAATGGAGAGGAAATGACACTCCGGCAGTTCCTG
GATTATTTCAAGAATGAACACAAACTGGAGATCACGATGC
TCTCTCAGGGAGTTTCTATGCTCTACTCTTTCTTCATGCC
TGCAGCCAAACTCAAAGAAAGACTGGAACTACCGATGACT
GAGATCGTGACCAAAGTGTCCAAGAAGAAACTGGGCAAGC
ATGTCAAAGCACTAGTGTTTGAGCTCTGCTGCAATGACGA
CACAGAAGAAGACGTAGAGGTGCCCTATGTCAGATACACC
ATCCGCTGACAGGGCTGATGGGTAGGACAGGGGACAGACT
AGAGGAGGGAGAGGGCGGCCCACTGGGGATGGGAGTGCAT
CAGTATGCTTGGAGAGCCCAAATCAAATCAATTGGTTTTA
TTTTAACCTGATGCTCAAGTATTATCTATCAATAACCTCT
TTTACCCTGCCGGTCGAGCTCTTTAAGGTCTAATTCAGTC
AGGTTGGTCATGTTCAGGAAATGGGGAGCATGTGAAGTTT
TGGCTGTAACTTATTTAAGCTGGTTTTTGTAACGCACAGC
ATCAGTGTGTGAATTTTATCATCACTCCCTTTCTGTGAAT
CCTCTTTCTCACACCGGTCCTCATGTGGGCAGCACCATCT
TGATTTGTTTTCCTGAATAAAATATTGACTGATGCCAAAA
AAAAATGAGTACAAATGGAAAAGATGTCAATGATGTTTGC
TTAAATAGATTTTTCAAATCATCGCCTTGGCTTGATGTCA
CCTTAAATGTAACTTGAAATGCGCTCTTATTGGCCAAGGT
TTTGGAGCAACGTACTGAACTCCTGTTCTCCCATTGGCCC
AGTGGGAACCTCCCTTTGCCTCTCTGGCTTCTGTATGGGG
TGGGTACAGGAACTTGCACATAACTTTTTGTTTTGTTTTT
CCCTCATTTTTTTATTTTTATTTTTTTGGCAGAATTCTGG
TGTACACCTTGTAGAACATAACCTCTGTATTCTTTCTACT
TTGTTAAACTCCAAAAAAAGACATTACAGTCTAAAACACA
TGATTTTACTCTGTAATGGGAGCACTTAGTGTGTTAGTGA
ATAAAGTTGGAAACGTTTTCTTTGCTTTATTGTCTCCTCT
TTGCTATTGTTGTTTTTAAGATGTGTCTAAACAGTTAATA
AAAACAGTCTTAGGTCAATCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations