header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9611
Transcript Name: uba1-202
Previous Name: uba1-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027022 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027022|OTTDARG00000021287|ZDB-GENE-040426-2009 uba1|OTTDARP00000022147 ube1-003 LG_ CR339046.11 Danio rerio protein_coding KNOWN, 862 bp
CACAGCTCCGCCCTTGTGCCTCAGCTGCCATTTTGGTTTT
GTTCCGTTCGCTGAAACAAAACCAGAAACGCGATACAGCA
GGCAGCAGACTGAACGACAGTGACTCGGCAGGATAGTGAA
GGGGGCTTTCTCACAGCATCTCGCCCAGCGCTGTTCGTGC
TGTTGCTGTTCGTTTTCTCCTCGCATCTTCACCCACCCGC
AATCCGCACCATCCAAGTTAGTTTCACACGAGGAGCGGTT
TGCTGACACTGAGAGTGGACTGAGAAGGATTATTGATGTC
CAGCTCGCCGCTGTCCAAGAAGCGTCGCGTGTCAGGATCA
GAGACGAAGACGGGATCCCATTGCTCCTCCTCTAACTCTG
TCAGAACTGAACTGTCACACACACCAGCTAACGGCATGGC
TAAGAATGGAAATGATGCTGAGATCGACGAGGGCCTGTAC
TCCAGACAGCTGTACGTGCTGGGTCATGATGCTATGAAGC
GTATGCAGAGCTCTAATGTTCTTATCTCGGGACTGCGAGG
TTTAGGGGTAGAGATCGCTAAGAATGTCATTCTGGGTGGA
GTCAAAAGCGTCACCCTGCACGATCAGGGAGTGGCCGAGT
GGAAGGACCTTTCATCACAGTTTTACCTGCGTGAGGAGGA
TCTTGGGAAGAACCGTGCTGATGTCAGTCAGCCTCGACTG
GCAGAACTGAACAGTTATGTGCCTGTAACCTCCTACACTG
GCACCCTCACCAATGAATACCTGACCAAATTTCAGGTTGT
TGTGCTCACCAACTCTAGTCTTGATGAACAGACACGTATC
GGGGAATTTTGCCACAGTAATGGCATCAAGTTGATTGTGG
CAGACACACGTGGACTGTTTGG

uba1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA uba1-004 (1) 810
mRNA uba1-201 (1) 4223
uba1-202 862
uba1-204 (1) 398
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
uba1-202 Contained in:

OTHER uba1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027022 (1)
  • Ensembl_Trans:ENSDART00000133131 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CO914733 (1) 874 bp
    GenBank:CK127937 (1) 760 bp
    CITATIONS (2)