ZFIN ID: ZDB-TSCRIPT-090929-9605
Transcript Name: hbs1l-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027016 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027016|OTTDARG00000021284|ZDB-GENE-030131-2987 hbs1l|no_translation hbs1l-003 LG_ BX927365.7 Danio rerio protein_coding KNOWN, 643 bp
AATCCACTGGGATTAGATGTCTTTAATTTATATTTTTTAA
CAACAGGCCGGTTGTATTCCTGTTTGGATCAGATGAGGAC
CGTACTGGGAGACTCAATTCCAGACTCCACATTGACTCAG
GCAGCTCTTAAATATGACTGTGATCCTCACCGAGCCCTTG
ATTTCATTCTGAGCGAGAACACCAATACACAAGCCCCTTC
TGCCAGAACCAACCCACAGCTGGAGCCTAACACCACAGCT
GCACCACAGAAAGGAGCCTTATTTCCTCTCTTACACAACA
GTAATAAGACTGTATCCAGTGCACATTCATGCAAACCCCT
AAAACAAAATCCATCATACAACCTCAGTGATCTGTTAGCA
GTGCCCGAGCCAAACATGACCAAACCTAAAGCTCAAAATC
CTCCCCCTGGTTTTGGAAGTTTGGCAAAAGACCATTTAAA
AGGAGTTTCAAGTCACAATTTGGGCAATGGGCAGTCAACT
ACTGGACAGAGTTCACTTGCTCATCTAATAGCTCAGCATG
AGCACAAGCATTCAACTGTTCCTCCTCTAGTTCCCTCCAC
TGGTCTCTCAACGGATTACACAATTCCCCTCACAACCAGT
CCTCTTGGCTCTTTTAATGGTCCGTCTGGCCCACTTTCTA
CAC

hbs1l TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hbs1l-201 (1)    Ensembl 1204
hbs1l-203 (1)    Ensembl 2424
ncRNA hbs1l-003 643
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hbs1l-003 Contained in:
[BAC] DKEY-161P7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000027016 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CD596824 (1) 650 bp
GenBank:CD596938 (1) 650 bp
GenBank:CD597776 (1) 650 bp
GenBank:CD598380 (1) 329 bp
CITATIONS (1)