header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9603
Transcript Name: hbs1l-203
Previous Name: hbs1l-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027014 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027014|OTTDARG00000021284|ZDB-GENE-030131-2987 hbs1l|OTTDARP00000022141 hbs1l-001 LG_ BX927365.7 Danio rerio protein_coding KNOWN, 2424 bp
ACTCCTGTGATGGCCGTCAAACATGGCGGCTGTGGAGTAA
GACGCATGTCTAAACTTTACACTGACAATTAATTTCCAGC
CTCGCGTACTTTGTTTACGTGAAAGAAAGCCGTCGAACAA
AAAATGTCCCGCCACAGGAATGTCCGAGGTTATAACTACG
ACGAAGACTTTGAAGATGATGACATGTATGGACAGTCAGT
GGAAGATGACTATTGCATCTCTCCAGCCACTGCCGCACAG
TTTATCTATTCGCGTCAAGATTCGAGGCAAGCTCGGCATG
TGGAGACTGTGGAGGAGGCAGAGTATGAAGAGGAAGAAGA
GGAGATGCCAACCTCTCCCACCATGACAAGCACACTAGAT
TCACTACAACAAGGCCGGTTGTATTCCTGTTTGGATCAGA
TGAGGACCGTACTGGGAGACTCAATTCCAGACTCCACATT
GACTCAGGCAGCTCTTAAATATGACTGTGATCCTCACCGA
GCCCTTGATTTCATTCTGAGCGAGAACACCAATACACAAG
CCCCTTCTGCCAGAACCAACCCACAGCTGGAGCCTAACAC
CACAGCTGCACCACAGAAAGCTAAAGTACGGGAGGCTCCA
GAGAGTCGCGTTGAATCGGAGGTCGTCCCAAAGGTTGCCC
GAATGACTGTGTCGGGTAAAAAGCAGACAATGGGCTTTGA
TGTGCGAAGTGCAGAGGAAAATGGCGGAGTGGCTCCTTCG
CTTCGCAGAGGGCCGAGTCCAGAGGCCACTGCTGTACCAA
CCACAGAAACCCCATCCAAACAGTCGACTGTGACTGAAGA
TTCTGCTGCTCCGACCCCAACTCGACCATCCGGAAAAAGC
AAACAGCAGCTCAACATCCGTGCTGAACTGGAGAAGAGAC
AAGGAGGAAAACCATTACTCAACCTGGTGGTCATAGGACA
TGTAGATGCTGGCAAGAGCACTCTCATGGGTCATCTGTTA
TATCTGCTGGGGAACGTTAACAAGAGAACCATGCATAAGT
ATGAACAGGAGGCCAAAAAAGCTGGCAAAGCCTCATTCGC
CTATGCATGGGTACTGGATGAGACAGGAGAGGAAAGGGAC
AGAGGAGTGACCATGGATGTGGGCATGACTAAGTTTGAGA
CTGACTCAAAGGTTGTTACTCTGATGGACGCACCAGGACA
CAAAGACTTCATCCCGAACATGATCACAGGGGCAGCACAG
GCAGATGTGGCAGTGTTGGTGGTAGATGCCAGCCGTGGGG
AGTTTGAGGCCGGGTTTGAGGCAGGAGGGCAGACCCGCGA
ACACGCTCTGCTGGTTCGATCCCTCGGAGTCACTCAGCTT
GCTGTTGCTGTCAACAAGATGGACCAGGTGAACTGGCAGC
AGGAGAGGTTTCAGGAAATCATCTCCAAGCTCGGCCACTT
TCTGAAGCAGGCTGGTTTTAAGGATTCTGATGTGTTTTAC
GTCCCAACTAGCGGCCTATCAGGAGAGAATCTAACCACTA
AGAGTAAAGTAGCAGACCTTACAGCCTGGTACACTGGACC
ATGCCTGGTGGAACAAATAGATGCTTTTAAACCTCCCCAG
CGGTCAGTGGAGAAGCCCTTCAGGCTCTGTGTGTCAGACG
TCTTTAAAGATCAGGGCTCTGGGTTCTGTGTGACTGGAAA
GATTGAGGCTGGCTACATTCAGACTGGAGATAAAGTGCTT
GCCATGCCGCCTAATGAGACCTGCACTGTTAAAGGGATCA
GTCTTCATGATGAAGCATTAGACTGGGCAGCGGCTGGTGA
TCATGTCAGTCTGACTGTAACAGGCATGGACATCATCAAA
ATAAATGTTGGATGTGTATTCTGTGATCCCAAAGAGCCCA
TTAGAGCCTGCACGCGATTCAGAGCAAGAATCCTCCTCTT
TAATATTGAACTTCCCATCACTCAAGGCTTCCCCGTCCTG
TTGCATTATCAGACTGTAAGTGAACCGGCCACCATTAGGA
AGTTAGTCAGTGTATTACACAAGAGCAGTGGAGAAGTTCT
CAAGAAAAAACCAAAGTGTTTGAGTAAAGGACAGAATGCA
GTGGTGGAGATTCAGACACAGAGACCTGTGGCTATGGAGC
TTTATAAGGACTATAAAGAACTGGGGCGGTTCATGCTGAG
ATACGTGGGCTCCACCATCGCTGCAGGAGTGGTCACAGAG
ATCAAAGAGTAAGAGCCTGTTGGAACTGGATCCTTCAGAT
TGTACTGACAGAAACCATCAGACTGAAGTGCAATTTCTCC
CTCAAAACGTACACAAACATGAAGTGAATACACAAAGATG
CCCAGCAGGCAAGCTAACAGTGAATCTAGCCTCAGCTCAC
GTTACATTTCACAGGCCTCGGGAGGGGAGAGTGAATGTTG
GTGTTTGTTTTCTTGTAGTCATTTTTGTCTTGTTTTCAGT
ACAAATAAAAAAAGCATTCTTAAA

hbs1l TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hbs1l-201 (1)    Ensembl 1204
hbs1l-203 2424
ncRNA hbs1l-003 (1) 643
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hbs1l-203 Contained in:
[BAC] DKEY-161P7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000027014 (1),  Ensembl_Trans:ENSDART00000139076 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC044162 (1) 2426 bp
GenBank:EB778636 (1) 428 bp
CITATIONS (2)