header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9604
Transcript Name: hbs1l-201
Previous Name: hbs1l-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027015 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027015|OTTDARG00000021284|ZDB-GENE-030131-2987 hbs1l|OTTDARP00000022142 hbs1l-002 LG_ BX927365.7 Danio rerio protein_coding KNOWN, 1204 bp
GTGATGGCCGTCAAACATGGCGGCTGTGGAGTAAGACGCA
TGTCTAAACTTTACACTGACAATTAATTTCCAGCCTCGCG
TACTTTGTTTACGTGAAAGAAAGCCGTCGAACAAAAAATG
TCCCGCCACAGGAATGTCCGAGGTTATAACTACGACGAAG
ACTTTGAAGATGATGACATGTATGGACAGTCAGTGGAAGA
TGACTATTGCATCTCTCCAGCCACTGCCGCACAGTTTATC
TATTCGCGTCAAGATTCGAGGCAAGCTCGGCATGTGGAGA
CTGTGGAGGAGGCAGAGTATGAAGAGGAAGAAGAGGAGAT
GCCAACCTCTCCCACCATGACAAGCACACTAGATTCACTA
CAACAAGGCCGGTTGTATTCCTGTTTGGATCAGATGAGGA
CCGTACTGGGAGACTCAATTCCAGACTCCACATTGACTCA
GGCAGCTCTTAAATATGACTGTGATCCTCACCGAGCCCTT
GATTTCATTCTGAGCGAGAACACCAATACACAAGCCCCTT
CTGCCAGAACCAACCCACAGCTGGAGCCTAACACCACAGC
TGCACCACAGAAAGGAGCCTTATTTCCTCTCTTACACAAC
AGTAATAAGACTGTATCCAGTGCACATTCATGCAAACCCC
TAAAACAAAATCCATCATACAACCTCAGTGATCTGTTAGC
AGTGCCCGAGCCAAACATGACCAAACCTAAAGCTCAAAAT
CCTCCCCCTGGTTTTGGAAGTTTGGCAAAAGACCATTTAA
AAGGAGTTTCAAGTCACAATTTGGGCAATGGGCAGTCAAC
TACTGGACAGAGTTCACTTGCTCATCTAATAGCTCAGCAT
GAGCACAAGCATTCAACTGTTCCTCCTCTAGTTCCCTCCA
CTGGTCTCTCAACGGATTACACAATTCCCCTCACAACCAG
TCCTCTTGGCTCTTTTAATGGTCCGTCTGGCCCACTTTCT
ACACTTCAGGGTCCCAATGTCCCACCTTTGTCTGTTGGCT
CTGCTGCGACTCTCTCTTTAGGATCCTCTGTCCCAGCTGG
TCTGGGTGCAACACCTTCCTCATGTCTGCTTACCTGCTCT
CTCAGTAATCTAGCACTGCAGGATTCCCAGCGGTCCGCCC
CTCTTCCTGTGTCTATAGGAAGTTTGAGCTCTGTCATGCG
AGGAAGTGGACCGCTGGGAGTACCAGTGCAGGGAAAAAGC
TCTG

hbs1l TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hbs1l-201 1204
hbs1l-203 (1)    Ensembl 2424
ncRNA hbs1l-003 (1) 643
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hbs1l-201 Contained in:
[BAC] DKEY-161P7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000027015 (1),  Ensembl_Trans:ENSDART00000134319 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EG582307 (1) 904 bp
GenBank:CO805867 (1) 849 bp
GenBank:CB354734 (1) 542 bp
CITATIONS (2)