Transcript

actr6-003

ID
ZDB-TSCRIPT-090929-9459
Name
actr6-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026856 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026856|OTTDARG00000021200|ZDB-GENE-030131-3543 actr6|no_translation actr6-003 LG_ CR385081.7 Danio rerio protein_coding KNOWN, 773 bp
AGAATAGAAGAAGTCGTCCATAGAGCGGCATGATTATTTA
ACAGGTTCAATGTTTATTTAAAAATACAGTTTGCTTTATA
ATCTGTAGCTTTAGTCATTTTGTCCATCCCACCTTATGAT
TTCCGTTCGAGTAACTGAGATGTAAACATGTCAACGCTAG
TGTTGGACAATGGCGCGTACTTCGCTAAAATCGGGTACAG
TCATGAGAAAGTCAGTGTTATTCCAAATAGCCAGTTCCGC
ACGAAGACCTCCAGGCTGAAAACATTCACTGCAAACCAGC
TGGACGAAATCAAAGACCCGTCTGGACTCTTCTACATTCT
CCCGTTTCAAAAGGGTTATCTTGTAAACTGGGATGTGCAG
CGCAAGGTTTGGGATCATCTGTTTGGAAAAGAGATGTTCA
AGGTGGACTTTGCTGATACCAACATTGTAATCACTGAACC
ATACTTCAACTTTTGCTCAATTCAAGAATCCATGAATGAG
ATTTTATTTGAGGAATACCAATTCCAGTCAGCGCTCAGAA
TTAACGCTGGATCTTTGAGTGCTCATCGATACTTCCACGA
GAATAACTCTGAGCTGTGCTGCATTGTGGTGGACAGTGGC
TTCTCCTTCACACACATTGTTCCTTATTGCAGGGGAAGGA
AAATGAAAGAGGGTATCTGCAGAATAAATGTTGGAGGAAA
ACTGCTCACCAATCATTTGAAGGAGATCATTTCATACAGG
TAAGCTCTCTACCATTTGAATAAGAAGATCGTTTGACGCT
TCTTCTCCTTGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations