Transcript

actr6-203

ID
ZDB-TSCRIPT-090929-9458
Name
actr6-203
Previous Names
  • actr6-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026855 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026855|OTTDARG00000021200|ZDB-GENE-030131-3543 actr6|OTTDARP00000022014 actr6-002 LG_ CR385081.7 Danio rerio protein_coding KNOWN, 548 bp
ATAGAAGAAGTCGTCCATAGAGCGGCATGATTATTTAACA
GGTTCAATGTTTATTTAAAAATACAGTTTGCTTTATAATC
TGTAGCTTTAGTCATTTTGTCCATCCCACCTTATGATTTC
CGTTCGAGTAACTGAGATGTAAACATGTCAACGCTAGTGT
TGGACAATGGCGCGTACTTCGCTAAAATCGGGTACAGTCA
TGAGAAAGTCAGTGTTATTCCAAATAGCCAGTTCCGCACG
AAGACCTCCAGGCTGAAAACATTCACTGCAAACCAGCTGG
ACGAAATCAAAGACCCGTCTGGACTCTTCTACATTCTCCC
GTTTCAAAAGGTGGACTTTGCTGATACCAACATTGTAATC
ACTGAACCATACTTCAACTTTTGCTCAATTCAAGAATCCA
TGAATGAGATTTTATTTGAGGAATACCAATTCCAGTCAGC
GCTCAGAATTAACGCTGGATCTTTGAGTGCTCATCGATAC
TTCCACGAGAATAACTCTGAGCTGTGCTGCATTGTGGTGG
ACAGTGGCTTCTCCTTCACACACATTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations