Transcript

actr6-201

ID
ZDB-TSCRIPT-090929-9457
Name
actr6-201
Previous Names
  • actr6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026854 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026854|OTTDARG00000021200|ZDB-GENE-030131-3543 actr6|OTTDARP00000022013 actr6-001 LG_ CR385081.7 Danio rerio protein_coding KNOWN, 1727 bp
TGTCCACTGTTTTTTCAGATCTGAAGAATAGAAGAAGTCG
TCCATAGAGCGGCATGATTATTTAACAGGTTCAATGTTTA
TTTAAAAATACAGTTTGCTTTATAATCTGTAGCTTTAGTC
ATTTTGTCCATCCCACCTTATGATTTCCGTTCGAGTAACT
GAGATGTAAACATGTCAACGCTAGTGTTGGACAATGGCGC
GTACTTCGCTAAAATCGGGTACAGTCATGAGAAAGTCAGT
GTTATTCCAAATAGCCAGTTCCGCACGAAGACCTCCAGGC
TGAAAACATTCACTGCAAACCAGCTGGACGAAATCAAAGA
CCCGTCTGGACTCTTCTACATTCTCCCGTTTCAAAAGGGT
TATCTTGTAAACTGGGATGTGCAGCGCAAGGTTTGGGATC
ATCTGTTTGGAAAAGAGATGTTCAAGGTGGACTTTGCTGA
TACCAACATTGTAATCACTGAACCATACTTCAACTTTTGC
TCAATTCAAGAATCCATGAATGAGATTTTATTTGAGGAAT
ACCAATTCCAGTCAGCGCTCAGAATTAACGCTGGATCTTT
GAGTGCTCATCGATACTTCCACGAGAATAACTCTGAGCTG
TGCTGCATTGTGGTGGACAGTGGCTTCTCCTTCACACACA
TTGTTCCTTATTGCAGGGGAAGGAAAATGAAAGAGGGTAT
CTGCAGAATAAATGTTGGAGGAAAACTGCTCACCAATCAT
TTGAAGGAGATCATTTCATACAGGCAGCTGCATGTGATGG
ACGAGACTCATGTGATCAATCAGGTCAAGGAGGATGTGTG
TTATGTGTCGCAGGATTTCTACAAGGACATGGAGATTGCA
CAATTAAAAGGTGAAGATAATACAGTGATGAAAGACTATG
TGCTGCCAGATTTCAGCTCCATCAAAAAGGGATTTTGCAA
GCCTCTAGAGGAGATGAATTTCACTGGCAAATACAAGACT
GGGGAGCAGATTTTGCGGCTCACCAATGAGAGGTTTGCTG
TCCCGGAGATGCTCTTTCACCCCTCTGACATTGGCATTCA
GGAGATGGGCATACCTGAAGCTTTGGTCAACTCCATTAAC
AACATGCCAGAAGAAATGCAGCCCCATTTCTATAAGAACA
TTCTTCTTACTGGCGGCAACACTTTGTTCCCTGGATTCAG
AGATCGGGTTTATAAAGAAGTCCGGGCTCTCGCTCCAGTT
GAATATGATGTTTCTGTCGTCTTGCCAAATAACCCTATTT
GCTACTCATGGGAAGGTGGAAAGTTGTTGGCAGAAAACCC
TGACTTTGAAGAGATGGCGGTCACCCGAGATGATTATGAG
GAAAATGGACATTATATATGCGAGGAGAAGTTTGATATTT
GACCTGTGTTGGGATTCTGTCTTTGGGTACAGAAAATCTG
AACACTGCACAGGTTTTGTTTGAAACTAAGGTGTACATTG
GCATATTTTTTCATTGCACTCATTATTATTCAATAGTTAG
CCTGTTTGATTTTCAATATAGCTTTGTATTAAGAAACTTT
TTTTGTATGAAAATAATGTGAACTGGAGAAATAAAAATGT
TTTTTTTTTTTTACCCTTTTGTTGGTTAAAAAGTGTATGT
ACTTATATAATTAAGTCTATTTAATGACAAAGCAAGCAAC
TTGTTTTAAGGTTTTGGGATTTTTAAAAGTGTTTCAATGT
AAAGAAAACCTCCAAAATACACTCAATCGTTTGTTTGCTA
TACTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations