Transcript

adka-004

ID
ZDB-TSCRIPT-090929-8762
Name
adka-004
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026068 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026068|OTTDARG00000020740|ZDB-GENE-030425-3 adka|no_translation adka-004 LG_none AL929334.12,CR788251.13 Danio rerio protein_coding KNOWN, 737 bp
ATTCGCTCAACAAGGTGCCAGGAGCGTATTTGATTGAGCA
CTATCACTGTACAGCATGGCGTCCGATGAACCTAAAGCAA
AGAGGATTAAACTCGAGGAAAAAAAGCTCAGTCAAAATGC
CCTTTTTGGGATGGGAAACCCCCTGCTTGACATCTGCGCT
GTGGTGGACAAAGACTTTCTAGACAAGTATGGGCTCAAGC
CAAATGACCAGATATTGGCAGAAGATAAACACAAGGAAAT
GTTTGAAGAGATGGTCAAGAAATTCAAGGTTGAATATCGT
GCTGGAGGTGCCACTCAGAACTCTGTGAAAGTTGCACAGT
GGATGATCCAGGAGCCGCACAATGTGGGCACCTTCTTCGG
CTGCATCGGAAAGGATAAGTTCGGGAAGATCCTGAAAGAG
AAGGCGGAGGAGGCCCACGTGGATGCCCACTACTATGAGC
AGAGTGAGGAGCCCACGGGGAGCTGCGCTGCCTGCATCAC
TGGCGACAACAGAGGTCTCTTGTTGCAAATCTCGCTGCCG
CTAATTGCTACAAGAAAGAGAAACACCTCGATCTGGAGGA
GAACTGGAAACTTGTTGAGAAAGCCCAAGTTTACTACATC
GCTGTGAGTAGAAAAGTCTCTCTTGACACTTTTGCCTTTT
TTGCAGTTTGTCACCATGTGATGCGAAGTGTTAAAGTACT
TTTTTTTCCAAGCTGGCAGTTTGATTATTGTTTTCTGAGC
CAAGCTTTCATATCGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations