header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8762
Transcript Name: adka-004
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026068 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026068|OTTDARG00000020740|ZDB-GENE-030425-3 adka|no_translation adka-004 LG_none AL929334.12,CR788251.13 Danio rerio protein_coding KNOWN, 737 bp
ATTCGCTCAACAAGGTGCCAGGAGCGTATTTGATTGAGCA
CTATCACTGTACAGCATGGCGTCCGATGAACCTAAAGCAA
AGAGGATTAAACTCGAGGAAAAAAAGCTCAGTCAAAATGC
CCTTTTTGGGATGGGAAACCCCCTGCTTGACATCTGCGCT
GTGGTGGACAAAGACTTTCTAGACAAGTATGGGCTCAAGC
CAAATGACCAGATATTGGCAGAAGATAAACACAAGGAAAT
GTTTGAAGAGATGGTCAAGAAATTCAAGGTTGAATATCGT
GCTGGAGGTGCCACTCAGAACTCTGTGAAAGTTGCACAGT
GGATGATCCAGGAGCCGCACAATGTGGGCACCTTCTTCGG
CTGCATCGGAAAGGATAAGTTCGGGAAGATCCTGAAAGAG
AAGGCGGAGGAGGCCCACGTGGATGCCCACTACTATGAGC
AGAGTGAGGAGCCCACGGGGAGCTGCGCTGCCTGCATCAC
TGGCGACAACAGAGGTCTCTTGTTGCAAATCTCGCTGCCG
CTAATTGCTACAAGAAAGAGAAACACCTCGATCTGGAGGA
GAACTGGAAACTTGTTGAGAAAGCCCAAGTTTACTACATC
GCTGTGAGTAGAAAAGTCTCTCTTGACACTTTTGCCTTTT
TTGCAGTTTGTCACCATGTGATGCGAAGTGTTAAAGTACT
TTTTTTTCCAAGCTGGCAGTTTGATTATTGTTTTCTGAGC
CAAGCTTTCATATCGCA

adka TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA adka-201 (1)    Ensembl 2605
adka-203 (1)    Ensembl 463
ncRNA adka-003 (1) 367
adka-004 737
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
adka-004 Contained in:

Genome Resources: Vega_Trans:OTTDART00000026068 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CT616398 (1) 735 bp
CITATIONS (1)