Transcript

adka-203

ID
ZDB-TSCRIPT-090929-8760
Name
adka-203
Previous Names
  • adka-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026066 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026066|OTTDARG00000020740|ZDB-GENE-030425-3 adka|OTTDARP00000021414 adka-002 LG_none AL929334.12,CR788251.13 Danio rerio protein_coding KNOWN, 463 bp
TAACATTGCAGACTCAGAGCTGTCTGGCTGATTTTAAACT
GCACTGAGCATCACCTCAAGCCTTCCTCATGCCAGCAGCC
AGTCAAAATGCCCTTTTTGGGATGGGAAACCCCCTGCTTG
ACATCTGCGCTGTGGTGGACAAAGACTTTCTAGACAAGTA
TGGGCTCAAGCCAAATGACCAGATATTGGCAGAAGATAAA
CACAAGGAAATGTTTGAAGAGATGGTCAAGAAATTCAAGG
TTGAATATCGTGCTGGAGGTGCCACTCAGAACTCTGTGAA
AGTTGCACAGTGGATGATCCAGGAGCCGCACAATGTGGGC
ACCTTCTTCGGCTGCATCGGAAAGGATAAGTTCGGGAAGA
TCCTGAAAGAGAAGGCGGAGGAGGCCCACGTGGATGCCCA
CTACTATGAGCAGAGTGAGGAGCCCACGGGGAGCTGCGCT
GCCTGCATCACTGGCGACAACAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations