header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8760
Transcript Name: adka-203
Previous Name: adka-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026066 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026066|OTTDARG00000020740|ZDB-GENE-030425-3 adka|OTTDARP00000021414 adka-002 LG_none AL929334.12,CR788251.13 Danio rerio protein_coding KNOWN, 463 bp
TAACATTGCAGACTCAGAGCTGTCTGGCTGATTTTAAACT
GCACTGAGCATCACCTCAAGCCTTCCTCATGCCAGCAGCC
AGTCAAAATGCCCTTTTTGGGATGGGAAACCCCCTGCTTG
ACATCTGCGCTGTGGTGGACAAAGACTTTCTAGACAAGTA
TGGGCTCAAGCCAAATGACCAGATATTGGCAGAAGATAAA
CACAAGGAAATGTTTGAAGAGATGGTCAAGAAATTCAAGG
TTGAATATCGTGCTGGAGGTGCCACTCAGAACTCTGTGAA
AGTTGCACAGTGGATGATCCAGGAGCCGCACAATGTGGGC
ACCTTCTTCGGCTGCATCGGAAAGGATAAGTTCGGGAAGA
TCCTGAAAGAGAAGGCGGAGGAGGCCCACGTGGATGCCCA
CTACTATGAGCAGAGTGAGGAGCCCACGGGGAGCTGCGCT
GCCTGCATCACTGGCGACAACAG

adka TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA adka-201 (1)    Ensembl 2605
adka-203 463
ncRNA adka-003 (1) 367
adka-004 (1) 737
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
adka-203 Contained in:

Genome Resources: Vega_Trans:OTTDART00000026066 (1),  Ensembl_Trans:ENSDART00000144227 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CA496528 (1) 909 bp
GenBank:CA474765 (1) 887 bp
GenBank:CK142919 (1) 767 bp
GenBank:AW128089 (1) 671 bp
GenBank:AW173870 (1) 585 bp
GenBank:AI437278 (1) 541 bp
GenBank:BM279794 (1) 469 bp
CITATIONS (2)