Transcript

adka-201

ID
ZDB-TSCRIPT-090929-8759
Name
adka-201
Previous Names
  • adka-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026065 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026065|OTTDARG00000020740|ZDB-GENE-030425-3 adka|OTTDARP00000021413 adka-001 LG_none AL929334.12,CR788251.13 Danio rerio protein_coding KNOWN, 2605 bp
GAACAGCATCCACCACCCTCACCGCCAGATGCTTCATTCG
CTCAACAAGGTGCCAGGAGCGTATTTGATTGAGCACTATC
ACTGTACAGCATGGCGTCCGATGAACCTAAAGCAAAGAGG
ATTAAACTCGAGGAAAAAAAGCTCAGTCAAAATGCCCTTT
TTGGGATGGGAAACCCCCTGCTTGACATCTGCGCTGTGGT
GGACAAAGACTTTCTAGACAAGTATGGGCTCAAGCCAAAT
GACCAGATATTGGCAGAAGATAAACACAAGGAAATGTTTG
AAGAGATGGTCAAGAAATTCAAGGTTGAATATCGTGCTGG
AGGTGCCACTCAGAACTCTGTGAAAGTTGCACAGTGGATG
ATCCAGGAGCCGCACAATGTGGGCACCTTCTTCGGCTGCA
TCGGAAAGGATAAGTTCGGGAAGATCCTGAAAGAGAAGGC
GGAGGAGGCCCACGTGGATGCCCACTACTATGAGCAGAGT
GAGGAGCCCACGGGGAGCTGCGCTGCCTGCATCACTGGCG
ACAACAGGTCTCTTGTTGCAAATCTCGCTGCCGCTAATTG
CTACAAGAAAGAGAAACACCTCGATCTGGAGGAGAACTGG
AAACTTGTTGAGAAAGCCCAAGTTTACTACATCGCTGGCT
TCTTTCTGACCGTGTCCTTGGAGTCGATCCTAAAGGTGGC
CAAACACGCTTCTGAAAACAACAAGATCTTCTGCTTGAAT
CTGTCAGCTCCGTTCATCTGCGAGTTTTTCAAGGAGGCCC
TGATGAAGGTGATGCCCTATGTCGACATCCTTTTCGGCAA
TGAAACGGAGGCCGCTGCGTTTGCACGGGAGCAAGGCTTC
GAGACCGAAGACATCGAGGAGATTGCGAAGAAGGCCCAAA
GCTTACCCAAAGAGAACAAGAAAAGGCAGAGGATTGTTGT
CTTCACCCAAGGCAAAGAAGGAACTGTAATGGCCAAAGGT
GACAAGGTGGAGACATTCCCTGTCCTGGAGATCGACCAGA
GCGAGATAGTGGACACCAATGGGGCTGGAGACGCTTTTGT
TGGAGGTTTCCTGTCTCAGCTGGTACAGGATAAGACCTTT
GAGCAGTGCATCCGCGCTGGGCACTACGCTGCTAACGTCA
TCATTCGCCACGCGGGCTGCACATTCCCAGAAAAGCCAGA
CTTCCACTGACGGGCCGCTGAGAGACCGGAAGATTTGGCC
GCACAAGTGTTTTATAGGACTAATGCCTTTCTTTTTTTTT
TCTTTTTTTAATTGACTTTTTATCTTCTTTTCCTCTTTCC
TCTCTTGTTCACTGCCTGCTGCCTTCCGTGCCTCGTGGGT
TTTTTCTGTCTCACGGCTTAATGCGATCACAGAGATGTTT
TTCACATTTCAACTGTTTACAAAAGAGGCAAAAAGAGGAA
TTTTTGTGATGAAAGTGTTGATTTGTTTTTAATGAGTCCA
TTTTAGTATTGCAGTTAAAGATCATGGTCAGAACGTATGA
AAGCTACTTTCTGCCATTGGAATAAAATGTAAAAATTTTT
GTTGTGACTTTTCTTCTTACAATTCTGAGATAAAATTGCA
AGATTATATTTGATTCTGGTTGATTACTCAGATTCTTGCA
AAAACAAAAAAAAACTTTCTATATAAACTTAATTGAAATA
AAGAATATAAACTCCCAAAAATTGGCAATTCAGAATGAAA
ATATTTAAAATTGTGAGATACAAACTCTTGACTTCTTTCG
GTCATGCTGTATATCTCTCAATTCAGTTTTTCTGAGAATT
GTAAGTTTTTCTGAGACTTGCAAATCTCACAGTTCTGACA
TTTTCTCAGAATTGCAACTTGTCGTGACAAATTTAACAGT
TCTTTCAACCAATTGTGAGTTTACACCTCTTCAAGTAAAA
AGAAAGCAGAATTGCGGCAAGAAATCATTTGCATGAAAAA
AGCCAGCCAATAAACTGGTTATTGCAAGAAATAGTCACAA
TTCTAACAGAAAAATCTAAAGTACAATACAAATTGGAAGA
AAATAAAGTTTAATAAATAAACTTTAAATTGCAAAAAAGC
TCGCAATTCTGAGAAAGTAAATACATAAAAAAACATACAT
ACAAACTCATACATACAAAGAATTTCAAAATAAATATAGT
TCCAATATGTTCAGTCTCACAATGTTGACTTTGTCACAGA
ATTCACTTTTTTTTTTTTGCAATGTACTGTCAGGTAAATA
AAAAAGTTAAGTATGAGACAAACAAAAAATTGCATTGAGT
TGAGTCACAATTACCATATTTTTATATTATTTTCATTTGT
TTGATCCTATGGCAGAAACAGGCGTCTGTATTTTAAGATG
TGACTGTTTGCTTACATAATTACCTTAATCATATGGTGAG
ACTGCTTTAAAAACTGATACGTAAATTACAAACATTGATT
ACAGTCGCCAGATGAATGATATGAACTTTAACGAAATCAA
AGGCTTGTTTTATCTCAGAGGAATTTTGTTGGCCAGTCCT
GCTGTTGTAAACCAAATGTAATTGTGAAAAGCACACTCGA
ATGTGTCACGATCAAAGAAATCTGTTGTTGTGTGAGCATA
ACCTCTGCCAAAATAAGAATAAAAGAGCCTGTATTACTGC
TGTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations