Transcript

atp2a2a-202

ID
ZDB-TSCRIPT-090929-7788
Name
atp2a2a-202
Previous Names
  • atp2a2a-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025012 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025012|OTTDARG00000020112|ZDB-GENE-040426-702 atp2a2a|OTTDARP00000028143 atp2a2a-002 LG_ CR407563.8 Danio rerio protein_coding KNOWN, 798 bp
AGTGAACGGACGAGAAGGACGGCGAAAGGGGTCGAGCGTC
ACATTTCCAGGCAGGCAGAGGCTTGGACGGGGCTGATTGT
GATGTACTAAGCAAGGAGCTTTTCTTTGGCGTTCACTGAC
ACACATTTCTTTGGGGCACAAGAAGAAGACTGTTTGGATA
AGACTCCTGGAAGGTGCATTTGCCCGTCTCAACTTTCCAC
ATATGTTCTTCATTGTGGATGTCAATGCATGTGTCACTCA
TAGGCATATTCTTATATTTTTGTTCTTCCTTTTTTTTTGT
AAACAAGGCAGATTTCTTGACTTGAGCGGGATTCTCTTCC
CATCTAACCATGGAGAACGCTCACACCAAGAGTGTGGAAG
AAGTTTATAGTAATTTCAGCGTCAACGAGAGCACGGGACT
GACTTTAGACCAGGTGAAAAGGAATAGAGACAAATGGGGT
CCTAACGAGTTGCCTGCAGAGGAAGGAAAGTCAATATGGG
AGCTTGTCATTGAGCAGTTTGAAGATTTACTTGTGCGGAT
TCTTCTACTGGCAGCTTGCATATCTTTTGTATTAGCCTGG
TTCGAGGAGGGGGAGGAAACTATCACTGCCTTTGTGGAGC
CTTTTGTAATCTTACTGATTCTTATAGCTAATGCCATCGT
CGGCGTTTGGCAGGAACGTAATGCAGAAAATGCCATTGAA
GCCCTCAAAGAGTACGAGCCAGAGATGGGCAAGGTGTACC
GTCAGGACAGGAAGTCCGTGCAAAGGATCAAAGCCAAAGA
CATCGTGCCTGGAGACATAGTGGAGGTCGCTGTGGGTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations